ID: 1067906291

View in Genome Browser
Species Human (GRCh38)
Location 10:50294702-50294724
Sequence GGGCTATGGTAGGCAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067906291_1067906296 -3 Left 1067906291 10:50294702-50294724 CCTGCCTCTGCCTACCATAGCCC No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data
1067906291_1067906305 26 Left 1067906291 10:50294702-50294724 CCTGCCTCTGCCTACCATAGCCC No data
Right 1067906305 10:50294751-50294773 GAGAACAGGTGTGCTTAGCCTGG No data
1067906291_1067906298 -2 Left 1067906291 10:50294702-50294724 CCTGCCTCTGCCTACCATAGCCC No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
1067906291_1067906300 0 Left 1067906291 10:50294702-50294724 CCTGCCTCTGCCTACCATAGCCC No data
Right 1067906300 10:50294725-50294747 ATTACCACACACACCACTGGGGG No data
1067906291_1067906299 -1 Left 1067906291 10:50294702-50294724 CCTGCCTCTGCCTACCATAGCCC No data
Right 1067906299 10:50294724-50294746 CATTACCACACACACCACTGGGG No data
1067906291_1067906302 12 Left 1067906291 10:50294702-50294724 CCTGCCTCTGCCTACCATAGCCC No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067906291 Original CRISPR GGGCTATGGTAGGCAGAGGC AGG (reversed) Intergenic