ID: 1067906292

View in Genome Browser
Species Human (GRCh38)
Location 10:50294706-50294728
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067906292_1067906305 22 Left 1067906292 10:50294706-50294728 CCTCTGCCTACCATAGCCCATTA No data
Right 1067906305 10:50294751-50294773 GAGAACAGGTGTGCTTAGCCTGG No data
1067906292_1067906299 -5 Left 1067906292 10:50294706-50294728 CCTCTGCCTACCATAGCCCATTA No data
Right 1067906299 10:50294724-50294746 CATTACCACACACACCACTGGGG No data
1067906292_1067906302 8 Left 1067906292 10:50294706-50294728 CCTCTGCCTACCATAGCCCATTA No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data
1067906292_1067906300 -4 Left 1067906292 10:50294706-50294728 CCTCTGCCTACCATAGCCCATTA No data
Right 1067906300 10:50294725-50294747 ATTACCACACACACCACTGGGGG No data
1067906292_1067906298 -6 Left 1067906292 10:50294706-50294728 CCTCTGCCTACCATAGCCCATTA No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
1067906292_1067906296 -7 Left 1067906292 10:50294706-50294728 CCTCTGCCTACCATAGCCCATTA No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067906292 Original CRISPR TAATGGGCTATGGTAGGCAG AGG (reversed) Intergenic
No off target data available for this crispr