ID: 1067906293

View in Genome Browser
Species Human (GRCh38)
Location 10:50294712-50294734
Sequence GTGTGGTAATGGGCTATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067906293_1067906305 16 Left 1067906293 10:50294712-50294734 CCTACCATAGCCCATTACCACAC No data
Right 1067906305 10:50294751-50294773 GAGAACAGGTGTGCTTAGCCTGG No data
1067906293_1067906302 2 Left 1067906293 10:50294712-50294734 CCTACCATAGCCCATTACCACAC No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data
1067906293_1067906300 -10 Left 1067906293 10:50294712-50294734 CCTACCATAGCCCATTACCACAC No data
Right 1067906300 10:50294725-50294747 ATTACCACACACACCACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067906293 Original CRISPR GTGTGGTAATGGGCTATGGT AGG (reversed) Intergenic
No off target data available for this crispr