ID: 1067906296

View in Genome Browser
Species Human (GRCh38)
Location 10:50294722-50294744
Sequence CCCATTACCACACACACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067906285_1067906296 29 Left 1067906285 10:50294670-50294692 CCTAAGCATTCCTCCAAGAGCCT No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data
1067906291_1067906296 -3 Left 1067906291 10:50294702-50294724 CCTGCCTCTGCCTACCATAGCCC No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data
1067906290_1067906296 -2 Left 1067906290 10:50294701-50294723 CCCTGCCTCTGCCTACCATAGCC No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data
1067906292_1067906296 -7 Left 1067906292 10:50294706-50294728 CCTCTGCCTACCATAGCCCATTA No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data
1067906288_1067906296 16 Left 1067906288 10:50294683-50294705 CCAAGAGCCTGGTGATTGCCCTG No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data
1067906287_1067906296 19 Left 1067906287 10:50294680-50294702 CCTCCAAGAGCCTGGTGATTGCC No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data
1067906289_1067906296 9 Left 1067906289 10:50294690-50294712 CCTGGTGATTGCCCTGCCTCTGC No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067906296 Original CRISPR CCCATTACCACACACACCAC TGG Intergenic
No off target data available for this crispr