ID: 1067906298

View in Genome Browser
Species Human (GRCh38)
Location 10:50294723-50294745
Sequence CCATTACCACACACACCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067906288_1067906298 17 Left 1067906288 10:50294683-50294705 CCAAGAGCCTGGTGATTGCCCTG No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
1067906290_1067906298 -1 Left 1067906290 10:50294701-50294723 CCCTGCCTCTGCCTACCATAGCC No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
1067906292_1067906298 -6 Left 1067906292 10:50294706-50294728 CCTCTGCCTACCATAGCCCATTA No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
1067906291_1067906298 -2 Left 1067906291 10:50294702-50294724 CCTGCCTCTGCCTACCATAGCCC No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
1067906289_1067906298 10 Left 1067906289 10:50294690-50294712 CCTGGTGATTGCCCTGCCTCTGC No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
1067906287_1067906298 20 Left 1067906287 10:50294680-50294702 CCTCCAAGAGCCTGGTGATTGCC No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
1067906285_1067906298 30 Left 1067906285 10:50294670-50294692 CCTAAGCATTCCTCCAAGAGCCT No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067906298 Original CRISPR CCATTACCACACACACCACT GGG Intergenic
No off target data available for this crispr