ID: 1067906302

View in Genome Browser
Species Human (GRCh38)
Location 10:50294737-50294759
Sequence ACCACTGGGGGCCTGAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067906293_1067906302 2 Left 1067906293 10:50294712-50294734 CCTACCATAGCCCATTACCACAC No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data
1067906294_1067906302 -2 Left 1067906294 10:50294716-50294738 CCATAGCCCATTACCACACACAC No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data
1067906289_1067906302 24 Left 1067906289 10:50294690-50294712 CCTGGTGATTGCCCTGCCTCTGC No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data
1067906292_1067906302 8 Left 1067906292 10:50294706-50294728 CCTCTGCCTACCATAGCCCATTA No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data
1067906295_1067906302 -8 Left 1067906295 10:50294722-50294744 CCCATTACCACACACACCACTGG No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data
1067906290_1067906302 13 Left 1067906290 10:50294701-50294723 CCCTGCCTCTGCCTACCATAGCC No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data
1067906297_1067906302 -9 Left 1067906297 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data
1067906291_1067906302 12 Left 1067906291 10:50294702-50294724 CCTGCCTCTGCCTACCATAGCCC No data
Right 1067906302 10:50294737-50294759 ACCACTGGGGGCCTGAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067906302 Original CRISPR ACCACTGGGGGCCTGAGAAC AGG Intergenic
No off target data available for this crispr