ID: 1067908619

View in Genome Browser
Species Human (GRCh38)
Location 10:50320797-50320819
Sequence GCCTCTGAGCCCAATCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067908619_1067908624 20 Left 1067908619 10:50320797-50320819 CCTTTGAGATTGGGCTCAGAGGC 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1067908624 10:50320840-50320862 GCTCCCAGCAGAGGTGCCTCCGG No data
1067908619_1067908623 11 Left 1067908619 10:50320797-50320819 CCTTTGAGATTGGGCTCAGAGGC 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1067908623 10:50320831-50320853 GCAGCTCATGCTCCCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067908619 Original CRISPR GCCTCTGAGCCCAATCTCAA AGG (reversed) Intronic
900162564 1:1231445-1231467 GCCTCTGAGCCAGACATCAAGGG + Intronic
901504914 1:9678669-9678691 GACTCTGAAACCAACCTCAAAGG + Intronic
903052518 1:20612295-20612317 GCCTCTGAGCCCAAGCTAAGCGG + Intronic
906430609 1:45752937-45752959 GCCACTGAGCCCAGCCTCAAAGG + Intergenic
907360872 1:53913575-53913597 TTCCCTGAGCCCCATCTCAAAGG - Intergenic
907917695 1:58885983-58886005 GGCTCTGGGCCCAGTGTCAAGGG - Intergenic
912996018 1:114533273-114533295 GCCACTAAGCCCAGTCTTAACGG - Intergenic
914709680 1:150201596-150201618 GCCACTGTGCCCATTCTCCAAGG - Intergenic
915107180 1:153541862-153541884 TCCACTGATCCCCATCTCAAGGG - Intergenic
915615115 1:157031682-157031704 GTCCCTGAACCCAATTTCAAGGG + Intronic
917377446 1:174364761-174364783 GTCTCAGAGCCCAAGGTCAATGG + Intronic
918564334 1:185910273-185910295 GCCTCTGAGAACAATTTCATAGG - Intronic
919927614 1:202200430-202200452 TCCTCTGAGCTCATTCTTAATGG + Intronic
1064467194 10:15595777-15595799 GCCACCGAGCCCAGCCTCAATGG - Intronic
1064911689 10:20408636-20408658 GTCTTAGAGCCCAATCTCTAAGG - Intergenic
1067908619 10:50320797-50320819 GCCTCTGAGCCCAATCTCAAAGG - Intronic
1069497570 10:68919843-68919865 GCCTCTGAGACCAATGACACTGG - Exonic
1070793962 10:79206262-79206284 GCCTCTGAGGTCCATCTCAGAGG - Intronic
1073306840 10:102509539-102509561 TCCTATGAGCCCAAACTCCAGGG - Intronic
1075946189 10:126435400-126435422 GACTCTGAGCTCAAGCTCAAGGG - Intronic
1076443809 10:130498220-130498242 GCCTCTGAGCCCAAACCCCCTGG - Intergenic
1076499818 10:130928752-130928774 GCCCCAGATGCCAATCTCAATGG - Intergenic
1079360558 11:19766971-19766993 GACTATGAGCCAAAACTCAAGGG - Intronic
1081285357 11:41262165-41262187 GTCTTTGAGCCAAATTTCAATGG + Intronic
1081764642 11:45601278-45601300 CCCTCTGAGCGCCATCACAAAGG - Intergenic
1081989044 11:47327827-47327849 CCCTCTGCTCCCAGTCTCAAGGG + Intronic
1084152063 11:67292277-67292299 GCCTCTGGGCTCACTCACAAGGG + Intronic
1084628977 11:70333195-70333217 ACCCCTATGCCCAATCTCAATGG - Intronic
1085454341 11:76657208-76657230 CCCTCTGTGCCCTATCTCAGAGG - Intergenic
1088896157 11:114079955-114079977 GCCCCGGAGCCCAAACTCACAGG - Intronic
1089189440 11:116643543-116643565 CCCTCTGACCCCAATCAGAAAGG + Intergenic
1095916741 12:47487381-47487403 GGCTTTGAGCCCAACCTCCAGGG + Intergenic
1097854155 12:64443739-64443761 GCCACTGTGCCCAGCCTCAATGG + Intronic
1099631502 12:85151968-85151990 GACTCTGAGCCAAATCTAGATGG - Intronic
1106035268 13:26038496-26038518 TCCTCTGATCCCCATCTCCATGG - Intergenic
1108034528 13:46274618-46274640 TCTTCTGACCCCATTCTCAATGG - Intronic
1109172703 13:59116404-59116426 CTCCCTGAGACCAATCTCAATGG + Intergenic
1112276831 13:98028864-98028886 GCCACTGCGCCCAGCCTCAATGG - Intergenic
1115366196 14:32559853-32559875 TCCTCTAAGCCTAATCTTAAGGG + Intronic
1118537072 14:66779027-66779049 GCCACTGCGCCCAGCCTCAAGGG + Intronic
1119562036 14:75598214-75598236 GCCTCTGCCCTCAATCTGAAGGG - Intronic
1121254372 14:92520385-92520407 GCCTTTGAGCCCATCCTCGAGGG + Intronic
1126826246 15:52552281-52552303 GCCACTGTGCCCAGTCTGAAGGG - Intronic
1127039525 15:54958957-54958979 GACTCTCAGCCCAATACCAAGGG + Intergenic
1128550954 15:68597683-68597705 GCCTCTGAGCTCCATAGCAATGG - Intronic
1129162451 15:73754024-73754046 ACCCCTGAGCTGAATCTCAAAGG + Intergenic
1129386148 15:75197126-75197148 GCCTCTGAGCTGAGTCTGAAAGG + Intronic
1130899366 15:88195553-88195575 CCCTCTGACCCCAATCCCATGGG - Intronic
1130931860 15:88434529-88434551 GCCACTGAGCCCAGTCAGAAAGG + Intergenic
1132954554 16:2584774-2584796 TCCTTTGAGCCCAAACTCTAAGG + Intronic
1132959791 16:2615389-2615411 TCCTTTGAGCCCAAACTCTAAGG - Intergenic
1133417177 16:5615949-5615971 GCCTCTCAGCCCAACTTCAGAGG - Intergenic
1134029022 16:10977157-10977179 GCCTTTGAGCCTAACATCAATGG - Intronic
1134543592 16:15089920-15089942 GCCACTGAGCCCAGCCTCAGTGG - Intronic
1135361171 16:21816079-21816101 GCCACTGAGCCCAGCCTCAGTGG - Intergenic
1135605889 16:23824281-23824303 GCCTGGGAGCCCCATCTCATTGG + Intergenic
1136261359 16:29079318-29079340 GCCACTGAGCCCAGCCTCAGTGG + Intergenic
1137524359 16:49221302-49221324 GCTTCTGAGGCTAATCTCAATGG - Intergenic
1138337032 16:56261347-56261369 GGCTCTGTGGCAAATCTCAAAGG + Intronic
1145188199 17:20814593-20814615 GCCTCTGCGCCCTCTCTCAGGGG - Intergenic
1147722118 17:42545811-42545833 GCCACCGTGCCCAACCTCAAAGG + Intergenic
1147946489 17:44083255-44083277 GCCACTGTGCCCAGCCTCAACGG + Intronic
1150632865 17:66892279-66892301 GCCTCTGAGCCCTTTCCCCAAGG + Intergenic
1151273542 17:73015419-73015441 CTCTCTGATCCCAAGCTCAAGGG + Intronic
1151930413 17:77228409-77228431 CCCTCTGATCCCAGCCTCAAAGG + Intergenic
1156471091 18:37377717-37377739 GCCTCTGACCCCAACCCCAAAGG - Intronic
1160854712 19:1211513-1211535 GCCTTCGAGCCCACTCTCACTGG - Intronic
1162107303 19:8377780-8377802 TCCTCTGAGCCCACTGTCACTGG + Intronic
1162750407 19:12826020-12826042 GGCTCTGACCCCAATCCCTAAGG - Intronic
1163084494 19:14969506-14969528 GCCTCTCAGCCTCATCTCATGGG - Intronic
1163993160 19:21018263-21018285 CCCACTGAGCCCAACCTAAATGG + Intergenic
1165126685 19:33603009-33603031 GGCGCTGAGCTCAGTCTCAAAGG - Intergenic
927169322 2:20355434-20355456 GCCACTGTGCTCAACCTCAAAGG + Intergenic
927209714 2:20631656-20631678 GCCACTGAGCCCTATCTTGAGGG + Intronic
927746178 2:25623483-25623505 GGCTCTGAGCCCAAACTAATAGG - Intronic
928532092 2:32202901-32202923 GCCTCTGAGACCAATGACACCGG - Intronic
928643599 2:33327108-33327130 GCCTTGGAGCCCACTCTCAGTGG + Intronic
929013374 2:37470292-37470314 GTATCTGAGCCCCAGCTCAATGG + Intergenic
929562166 2:42962679-42962701 GCGTCTGAGCCCTCCCTCAATGG - Intergenic
932773207 2:74513247-74513269 CTCTCTGAGCCCAGTCTCACCGG + Intergenic
935293314 2:101627720-101627742 GGCTCTGAGCACAGGCTCAAAGG - Intergenic
936944637 2:117919366-117919388 GCATTTGAGCCCTATCTAAAGGG - Exonic
937137503 2:119566695-119566717 GCTTCTGAGCCCTACCTCACTGG + Intronic
937849668 2:126621153-126621175 GGCACTGAGCTCAATCTCATGGG + Intergenic
947382210 2:229555442-229555464 GTCTCTGAGCTGGATCTCAATGG - Intronic
947464003 2:230325544-230325566 TCCTCTGATCCCAGTCTCCATGG - Intergenic
947857452 2:233333712-233333734 TCCTCTGAGCCCAACCCCAAGGG + Intronic
948067402 2:235091475-235091497 GCCACTGTGCCCAGTCTCATTGG + Intergenic
948665859 2:239534592-239534614 GCCACAGAGCCCACACTCAACGG - Intergenic
1170331266 20:15213453-15213475 GCCTCTTAGCAAAATCTAAAGGG + Intronic
1179793348 21:43768224-43768246 GCCTCTGCGCCCACACTCCAGGG - Intergenic
1181850525 22:25746833-25746855 GCCACTGCGCCCAGCCTCAAAGG - Intronic
1183437119 22:37802692-37802714 GCCTCTGCGCCCAAGCCCCAGGG + Intergenic
1185275416 22:49948436-49948458 GCCGCTGAGCCCACCCTCTAGGG - Intergenic
952365188 3:32667997-32668019 GCCTCTAACCCCAGACTCAAGGG - Intergenic
954822431 3:53341974-53341996 GCCTCAGAGCCCAGTTTAAAAGG + Intronic
956034652 3:65078124-65078146 GACCATGAGCTCAATCTCAAAGG - Intergenic
956293207 3:67683538-67683560 GCTTCTTAGCCCAATCTTCATGG + Intergenic
958728302 3:97932864-97932886 GCTTGTGAGCTCAGTCTCAAAGG - Intronic
961674224 3:128555186-128555208 GCCCCTGAGCCCAATCCCCTGGG - Intergenic
962409514 3:135128967-135128989 CCCTCTGAGTCCATTCTCCAGGG + Intronic
966680018 3:182631941-182631963 GCCTCTGAGGCAGATCTCACAGG + Intergenic
971784521 4:31083564-31083586 GCGTCTGAGCCAAATTTTAAAGG + Intronic
978668064 4:111210752-111210774 GCCACTGAGCCCTGTCTCCAGGG - Intergenic
984468366 4:180130151-180130173 GCCACTGTGCCCAGTCTGAAAGG + Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
987118316 5:14744189-14744211 CCTTCTGAGTCCACTCTCAAAGG + Intronic
990024348 5:51167223-51167245 TCCTCTGAACCCAACCTCAGAGG - Intergenic
992772131 5:80058887-80058909 GCCTCTGAGCCAGATCTCCGGGG + Intronic
992925659 5:81583341-81583363 GCCACTGCGCCCAGCCTCAATGG - Intronic
999427941 5:151503824-151503846 GCCCCAGAGCCCCATCTAAATGG + Intergenic
1004299730 6:14446368-14446390 GCCTCTCAGCCCCATGTCATTGG - Intergenic
1004475475 6:15967403-15967425 GCCACTGTGCCCAGCCTCAAAGG - Intergenic
1006416953 6:33910344-33910366 GGCTCTGAGACCAAACGCAAAGG - Intergenic
1006897696 6:37481318-37481340 GCCTCAGTGCCCTATCTCCATGG - Exonic
1014692071 6:124574329-124574351 GCCACTGTGCCCAACCTCACTGG - Intronic
1017116802 6:150985387-150985409 GCCACTGTGCCCGACCTCAAAGG - Intronic
1017296362 6:152799931-152799953 TCCTCTGTGCTCAAGCTCAATGG - Intergenic
1019014588 6:168870784-168870806 GCCTCTGAGACAAGTCTCAATGG - Intergenic
1029113135 7:98223542-98223564 GCCTCTGACCTCAGTCCCAAGGG - Intronic
1032558195 7:132859902-132859924 GCCTCTGATTCCATACTCAATGG + Intronic
1034899990 7:154902183-154902205 GAGTCTGCGCCCACTCTCAAGGG - Intergenic
1036973696 8:13384228-13384250 GCCTCTGCCCCCCATCACAAAGG + Intronic
1038566924 8:28627222-28627244 GCCACTGCGCCCAGCCTCAAGGG - Intronic
1038878325 8:31577545-31577567 GTGTCTGAGCCCAGTGTCAAGGG - Intergenic
1042412706 8:68482559-68482581 GCCACTGTGCCCAGTCTAAAGGG + Intronic
1042868681 8:73378263-73378285 GCCACTGCGCCCAGCCTCAAGGG + Intergenic
1044241119 8:89890119-89890141 TCCTCTGAGACCAAACTCTAGGG + Intergenic
1047779009 8:128096805-128096827 GCCTCTGAGGACAATGACAATGG - Intergenic
1051596792 9:18832149-18832171 GGGTCTGAGCCAAATCTGAATGG - Intronic
1057258908 9:93573304-93573326 GCCTTTGGCCCCAAACTCAATGG - Intergenic
1060356780 9:122915325-122915347 GCCTCTGAACCAATTCTTAAAGG + Intergenic
1061921854 9:133787000-133787022 GCCTCTGACCCCGAGCTCCAGGG + Intronic
1187160875 X:16764159-16764181 GCCACTGCGCCCAACCTTAATGG + Exonic
1188587768 X:31799053-31799075 GACTCTGATCCCCAGCTCAAGGG + Intronic
1188829680 X:34881233-34881255 GCCACTGTACCCAGTCTCAATGG + Intergenic
1194143826 X:90239566-90239588 CCTTCTGAGCACAATCTCAATGG + Intergenic
1199200257 X:145079062-145079084 GCCTCTGAGCCCCCTCTGTAAGG + Intergenic
1199866163 X:151852088-151852110 CCCTCTGAGCCAAAACTCAGTGG + Intergenic
1200489588 Y:3808867-3808889 CCTTCTGAGCACAATCTCAATGG + Intergenic