ID: 1067908662

View in Genome Browser
Species Human (GRCh38)
Location 10:50321194-50321216
Sequence TACATCAAATGTTAAATATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067908661_1067908662 19 Left 1067908661 10:50321152-50321174 CCTTTAGAAAGGCTAGAGTTTAT 0: 1
1: 0
2: 1
3: 10
4: 193
Right 1067908662 10:50321194-50321216 TACATCAAATGTTAAATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067908662 Original CRISPR TACATCAAATGTTAAATATA AGG Intronic
No off target data available for this crispr