ID: 1067916538

View in Genome Browser
Species Human (GRCh38)
Location 10:50406008-50406030
Sequence GTGTATATATATATTTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1579
Summary {0: 1, 1: 2, 2: 28, 3: 235, 4: 1313}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067916538 Original CRISPR GTGTATATATATATTTAGGT GGG (reversed) Intronic
900994953 1:6116259-6116281 GTGTGTATATATATGTTTGTTGG + Intronic
901474178 1:9478113-9478135 GTGTATATGTGTATGTATGTTGG - Intergenic
901888078 1:12238188-12238210 TTATATATATATATTTTGGGGGG - Intronic
902418922 1:16262192-16262214 ATGTATATATATTTTAAGATGGG + Intronic
902584676 1:17431364-17431386 ATATATATATATATATATGTGGG + Intronic
903171102 1:21554323-21554345 GTGTGTATATATATATATATGGG - Intronic
903547434 1:24134936-24134958 TTGTATATATACATTTTGGCAGG - Intronic
903602846 1:24555058-24555080 ATGTATATATATATTTTGGTAGG - Intergenic
903602847 1:24555062-24555084 GTGTATGTATATATATATTTTGG - Intergenic
903627032 1:24738259-24738281 ATATATATATATATTTATGGAGG - Intergenic
903817739 1:26077220-26077242 ATATATATATATATATAGGCTGG + Intergenic
905155108 1:35971021-35971043 ATATATATATATATTTAGGCTGG - Intronic
905575353 1:39039794-39039816 TTGTATATATATATTTCTTTTGG - Intergenic
905624282 1:39477005-39477027 GTGTGTATATATATCTAAGAGGG - Intronic
905935989 1:41824734-41824756 ATATATATATATATTTAACTTGG - Intronic
906300852 1:44680617-44680639 GTTTGTATATTTATTTGGGTTGG + Intronic
906384391 1:45354832-45354854 ATATATATATATATATATGTTGG + Intronic
906904177 1:49870549-49870571 GTAGATATATATATTTATGGGGG - Intronic
906982473 1:50646238-50646260 GTGTGTATATATGTATGGGTGGG - Intronic
907209079 1:52803065-52803087 GTGTATATATATATATATAGTGG - Intronic
907991742 1:59589237-59589259 GGGTGCATATATATTTAGGATGG - Intronic
907994244 1:59612947-59612969 GGGTACATATATATTTAGGATGG - Intronic
908130863 1:61074259-61074281 ATATATATATATATATATGTTGG + Intronic
908280139 1:62524922-62524944 ATATATATATATAGTTTGGTTGG - Intronic
908280140 1:62524926-62524948 ATATATATATATATATAGTTTGG - Intronic
908708654 1:66990692-66990714 GTGTATATGTATAGTTAGTTAGG + Intergenic
908875087 1:68664150-68664172 ATATATATATATATATAGTTTGG - Intergenic
908929346 1:69298525-69298547 ATATACATATATATTTAGGATGG + Intergenic
908962359 1:69713332-69713354 GTATATATATATATTTAGACAGG + Intronic
908965362 1:69755323-69755345 GTGTATATATATATTCCTTTTGG - Intronic
908975670 1:69894928-69894950 GTGTACATAAAAATTTAGGCCGG + Intronic
909115492 1:71529560-71529582 GTGTATTTTAATATTTATGTTGG - Intronic
909349808 1:74638011-74638033 TTGTACATATATATTTAGGAAGG + Intronic
909403550 1:75260475-75260497 GGGTGCATATATATTTAGGATGG - Intronic
909458922 1:75885339-75885361 GTGTATATATATATATATAAAGG + Intronic
909473718 1:76058510-76058532 GTGTATATATATATATATGTGGG - Intergenic
909499754 1:76320991-76321013 ATATATATATATAGTCAGGTAGG + Intronic
909717968 1:78733104-78733126 ATGTATGTATATTTTTAGGAGGG - Intergenic
909824326 1:80108448-80108470 GTGTGTATATATATATATGTAGG - Intergenic
909913152 1:81285216-81285238 GTGTATATATATATATATACAGG + Intergenic
910111477 1:83688201-83688223 GGGTGCATATATATTTAGGATGG + Intergenic
910502304 1:87906722-87906744 GTGTGTACATATATGTAGGTAGG - Intergenic
910661848 1:89681815-89681837 CTGTATATATATTTATATGTAGG + Intronic
910668905 1:89753393-89753415 ATGTATACATATAGTTTGGTTGG + Intronic
910754075 1:90667813-90667835 GTGTATGAATATATATAGGCAGG + Intergenic
910831801 1:91468905-91468927 GTGTATATATATATATATGAAGG + Intergenic
910945918 1:92591562-92591584 GGGTGCATATATATTTAGGATGG - Intronic
911001934 1:93175298-93175320 GTGTATATATATATATATATAGG - Intronic
911389983 1:97229537-97229559 ATATATATATATACTTAGGATGG - Intronic
911618102 1:100037302-100037324 ATGTGTATGTATATGTAGGTGGG - Intergenic
911761518 1:101622655-101622677 ATGTGTATATATATCCAGGTGGG + Intergenic
911785439 1:101940675-101940697 CTGGATATATATATATAGCTGGG - Intronic
911831797 1:102559166-102559188 GTGTATATATGTACATACGTAGG + Intergenic
911874971 1:103149330-103149352 GTGTGTATCTATATTTAAGATGG + Intergenic
911875336 1:103155192-103155214 GTGTGTATATATATGTGTGTGGG + Intergenic
911877221 1:103182093-103182115 TTTTATATATATATTTAAATGGG - Intergenic
912037892 1:105345066-105345088 ATGTATACATATACTTATGTAGG - Intergenic
912054859 1:105582054-105582076 ATATATATATATATTTTGGGTGG + Intergenic
912127257 1:106554769-106554791 GTGTATATATATATCTCAGTAGG + Intergenic
912132345 1:106619027-106619049 ATATATATATATATTTAGACGGG - Intergenic
912890673 1:113526357-113526379 GTGTATAGACATATTAATGTAGG + Intronic
913016483 1:114741736-114741758 GTCAATATATATTTTTAGCTTGG + Intronic
913033341 1:114934857-114934879 GGGTACATATATATTTAGGATGG - Intronic
913320338 1:117583421-117583443 GTGTATATGTATATGTTTGTGGG + Intergenic
913397412 1:118387209-118387231 GTATATATATATATATTGGTGGG - Intergenic
914430592 1:147617578-147617600 GTGAATATATATATAAATGTTGG - Intronic
915182566 1:154075307-154075329 GTGTATATATATGTATACGTGGG - Intronic
915244442 1:154546366-154546388 ATATATATATATATTTTGGCCGG - Intronic
915698897 1:157772034-157772056 ATATATATATATATTTAGCAGGG + Intronic
915847330 1:159280184-159280206 GTGTGTATATATATATATATGGG + Intergenic
916302036 1:163286033-163286055 CTGTATATATATATATAGTGGGG - Intronic
917019622 1:170571629-170571651 GGGTGCATATATATTTAGGATGG - Intergenic
917207680 1:172594974-172594996 GTGCATATATGTATTTAGGATGG + Intronic
917221180 1:172730368-172730390 GGGTACACATATATTTAGGATGG - Intergenic
917960339 1:180138843-180138865 GTGTGTATATATATATAAGTGGG + Intergenic
917960344 1:180138900-180138922 GTGGGTATATATATATAAGTGGG + Intergenic
917960347 1:180138957-180138979 GTATATATATATATATAAGTGGG + Intergenic
918532530 1:185539009-185539031 GTGTATACATATATGTATATCGG - Intergenic
918717592 1:187809664-187809686 TTGTATGTATGTATGTAGGTAGG - Intergenic
919000792 1:191828583-191828605 GTGCATATATATATATATATGGG + Intergenic
919009254 1:191938493-191938515 GTATATATATATATATATATAGG + Intergenic
919043255 1:192419953-192419975 GTGTATATACATATGTAGGTAGG + Intergenic
919090243 1:192970268-192970290 TTGTATGTATATATGTATGTAGG - Intergenic
919169959 1:193940962-193940984 GTATATATATATATATATGTGGG - Intergenic
919415886 1:197308922-197308944 GGGTATATATACATATATGTGGG + Intronic
919548657 1:198956612-198956634 GTATATATATATATTTACAATGG + Intergenic
919553230 1:199018985-199019007 GTGTATATATATATTTATTTTGG + Intergenic
919580103 1:199360997-199361019 GTGTGTATATATATATATATAGG + Intergenic
919674816 1:200370773-200370795 ATGAATATATATATATAGATGGG + Intergenic
919890220 1:201967011-201967033 GTGTGTATATATATATAGTGAGG + Intronic
920570997 1:207017370-207017392 ATGTATATATATATACATGTAGG - Intronic
920793882 1:209119729-209119751 ATATATATATATATTTCAGTGGG - Intergenic
920856353 1:209665753-209665775 GTGTTTATTTTTATTTAGATGGG + Intergenic
920947396 1:210542499-210542521 ATATATATATATATATTGGTTGG + Intronic
921412301 1:214848838-214848860 GTGTATATATATATATATGAGGG - Intergenic
921449952 1:215293840-215293862 GTGTATTTATATATATCTGTTGG - Intergenic
921658902 1:217775682-217775704 CTATATATATATATATAGATCGG - Intronic
921677848 1:217996479-217996501 ATATATATATATATATATGTAGG + Intergenic
921786112 1:219231512-219231534 GTGTATATATATGTATATGTGGG + Intergenic
921847246 1:219897243-219897265 GTGTATATGTGTATGTATGTTGG - Intronic
921989769 1:221352139-221352161 GTACATATATATATATATGTAGG + Intergenic
922415198 1:225415373-225415395 GTGTATATATGTATATATGATGG - Intronic
922979750 1:229815652-229815674 TTATATATATATATATAAGTGGG - Intergenic
923218105 1:231868722-231868744 ATATATATATATATTTAGCTGGG + Intronic
923370190 1:233302641-233302663 CTGTATATATATATATATGATGG - Intergenic
923378691 1:233392714-233392736 GTATATATATATTTTTTAGTAGG - Intergenic
923615293 1:235532291-235532313 GTATATATATATATATGGTTTGG - Intergenic
923642383 1:235778090-235778112 ATATATATATATATTTAACTGGG - Intronic
923787428 1:237081508-237081530 GTATATATATATATATATGTGGG - Intronic
923831996 1:237568495-237568517 ATGTATATATATAAAAAGGTTGG + Intronic
923933480 1:238731245-238731267 GTTTATATAAATATCTTGGTGGG + Intergenic
924225733 1:241920243-241920265 ATATATATATATAATTAGCTGGG - Intergenic
924395377 1:243613108-243613130 GTATATGTATATATATGGGTGGG - Intronic
924660270 1:246009461-246009483 GTGAATATATATTTTTAACTGGG + Intronic
924693788 1:246378636-246378658 GTGTATATATATATATATGAAGG - Intronic
924807586 1:247373556-247373578 ATATATATATATATTTAGCCGGG + Intergenic
924900651 1:248395278-248395300 GGGTGCATATATATTTAGGATGG + Intergenic
1063307243 10:4915682-4915704 ATATATATATATATGTAGGCTGG - Intergenic
1063307244 10:4915686-4915708 ATATATATATATATATATGTAGG - Intergenic
1063331179 10:5161049-5161071 GTGTGTATATATATGTGTGTGGG + Intergenic
1063438268 10:6051812-6051834 ATATATATATATATATAGCTGGG - Intronic
1063456681 10:6187994-6188016 ATATATATATATATGTAGGTAGG - Intronic
1063456682 10:6187998-6188020 ATATATATATATATATATGTAGG - Intronic
1063470549 10:6281162-6281184 GTATATATATATATATATGATGG - Intergenic
1063572607 10:7230023-7230045 ATATATATATATATTTAAGATGG + Intronic
1063611397 10:7565005-7565027 ATGTATATATGTATATATGTAGG - Intronic
1063622011 10:7658303-7658325 ATGTATATATATATTTTGGGTGG - Intronic
1063838245 10:10041214-10041236 GTGTATATATGTATATATGATGG + Intergenic
1063851077 10:10191295-10191317 GTGTGTATAGATAGATAGGTAGG + Intergenic
1063879007 10:10511459-10511481 GTGTATATATATTTATATATGGG + Intergenic
1063921484 10:10937837-10937859 GTATATATATATATGGAGGGAGG + Intergenic
1064134909 10:12742139-12742161 GTGTATATATATTTTTAGACAGG + Intronic
1064195560 10:13241434-13241456 ATATATATATATCCTTAGGTAGG - Intergenic
1064434717 10:15301339-15301361 ATATATATATATATATAGCTGGG - Intronic
1064438454 10:15331749-15331771 GTGTATGTATATATATATGTGGG + Intronic
1064438456 10:15331795-15331817 GTGTATATATGTATATATGTGGG + Intronic
1064588612 10:16865268-16865290 ATGTATAAATATGTTCAGGTAGG - Intronic
1064655936 10:17556221-17556243 TACTATATATATATTTAGGCTGG + Intergenic
1064672077 10:17725390-17725412 GTGTATACATATATATATATAGG + Intergenic
1064852050 10:19719149-19719171 GTATATATATATATATAATTTGG - Intronic
1065030902 10:21584712-21584734 GTGTATATATATTTATATGTAGG + Intronic
1065157791 10:22888080-22888102 GGGTGCATATATATTTAGGATGG - Intergenic
1065364313 10:24920315-24920337 GTGTATATATATATATACCATGG + Intronic
1065457152 10:25918681-25918703 GTGTATATATATGTATATATAGG - Intergenic
1065606628 10:27424813-27424835 ATCTATATATATATATAGATAGG - Intergenic
1065786199 10:29217982-29218004 GTATATATATATGTATACGTTGG + Intergenic
1065851019 10:29789099-29789121 ATATATATTTATATTTATGTTGG + Intergenic
1066641526 10:37558892-37558914 GTGTGTATATATATATATCTTGG + Intergenic
1066695249 10:38071464-38071486 GTGTATATATACATTTTAGATGG - Intergenic
1067106082 10:43367462-43367484 GTGTATATATATATATATATGGG - Intergenic
1067155526 10:43778304-43778326 GTATATATATATATTTAGGTTGG + Intergenic
1067724421 10:48759041-48759063 ATATATATATATCTTAAGGTAGG + Intronic
1067726125 10:48772442-48772464 GTGTGTATGTGTATTTGGGTGGG + Intronic
1067754002 10:48990889-48990911 GTATATGTATACATATAGGTAGG - Intergenic
1067916538 10:50406008-50406030 GTGTATATATATATTTAGGTGGG - Intronic
1067993072 10:51237704-51237726 GTCTTTATAGATATTTAGGGAGG - Intronic
1068077463 10:52274514-52274536 GTATATATATATATATATGATGG - Intronic
1068190770 10:53649725-53649747 GTGTGTATATATATTTATACAGG + Intergenic
1068249285 10:54416122-54416144 GTGTATATATATATTTAGCTTGG - Intronic
1068249646 10:54421951-54421973 ATATATATATATATTTAGGGAGG + Intronic
1068281283 10:54873570-54873592 GTGTGTATATATATATATGTTGG + Intronic
1068281290 10:54873779-54873801 GTGTGTGTATATATATATGTTGG + Intronic
1068288125 10:54965621-54965643 ATATATATATATATATATGTTGG + Intronic
1068292640 10:55024075-55024097 ATATATATATATATATAGGAAGG + Intronic
1068292644 10:55024123-55024145 ATATATATATATATATAGGAAGG + Intronic
1068459186 10:57304617-57304639 GTGTATCTATATATTTGTTTTGG + Intergenic
1068469802 10:57447153-57447175 GGGTGCATATATATTTAGGATGG + Intergenic
1068478470 10:57559103-57559125 GTGTATATATAAATATATATAGG - Intergenic
1068740917 10:60469463-60469485 GTATATATATATATATATGGTGG + Intronic
1068740919 10:60469485-60469507 GTATATATATATATATATGGTGG + Intronic
1069006550 10:63323830-63323852 GTGTATACATATATATATATAGG + Intronic
1069067940 10:63963810-63963832 GTGTATATGTATATGTATATAGG + Intergenic
1070245508 10:74727978-74728000 ATATATATATATATTTAGCCAGG + Intergenic
1070311099 10:75274586-75274608 GTGTATATATATATATATAATGG - Intergenic
1070706657 10:78644095-78644117 TTGTATATGAATACTTAGGTGGG + Intergenic
1070908168 10:80093181-80093203 ATATATATATATATTTTGGGAGG + Intergenic
1071083705 10:81842950-81842972 GTGTATATATATATATAAAATGG - Intergenic
1071106453 10:82102627-82102649 GTGTGTATATTTATTTGTGTGGG - Intronic
1071312722 10:84358617-84358639 ACATATATATATATTTAGATAGG - Intronic
1071466147 10:85941688-85941710 TTGTGCATATATATTTAGATAGG - Intronic
1072422196 10:95298419-95298441 TTGTATATGTATGTTTATGTAGG + Intergenic
1072501799 10:96025205-96025227 ATATATATATATATATAGCTGGG + Intronic
1072678158 10:97484473-97484495 GTGTATATGTATATATATGAAGG - Intronic
1073238900 10:102041095-102041117 ATATATATATATATATATGTAGG + Intronic
1073585582 10:104706773-104706795 GTGCATATACATGTTTATGTAGG - Intronic
1073682671 10:105721221-105721243 GTGTATATATACATACGGGTAGG + Intergenic
1074119126 10:110480234-110480256 GTGTATGTATATATATAGTCTGG - Intergenic
1074172288 10:110953734-110953756 ATATATATATATATTTTGATAGG + Intronic
1074323302 10:112423228-112423250 ATATATATATATATATAGGCTGG + Intronic
1074752791 10:116602841-116602863 GTGTATGTATATTTGTATGTGGG + Intronic
1074991778 10:118715197-118715219 GTGTATATATATATTTTTAGTGG - Intronic
1075285059 10:121176723-121176745 GTGTATATATATATATATTCAGG - Intergenic
1075510513 10:123068723-123068745 GTGAATATATATGTATACGTAGG - Intergenic
1075767694 10:124907256-124907278 GTGTATATATATGTGTGTGTGGG + Intergenic
1076012130 10:126997624-126997646 GTGTATATATATATACTGGTGGG - Intronic
1076078483 10:127556601-127556623 GTGTGTATATATATATGTGTGGG + Intergenic
1076142687 10:128092190-128092212 ATGTTTATATAGATTTAGGTTGG - Intergenic
1076256984 10:129034999-129035021 GTATATATGTATTTTTAAGTGGG - Intergenic
1077738093 11:4813013-4813035 ATGTATATATATATATATATGGG + Intronic
1078024781 11:7684469-7684491 GTGTATATATATATATATATAGG - Intergenic
1078262663 11:9725385-9725407 ATATATATATATATTTTGGCTGG + Intronic
1078310236 11:10233538-10233560 ATATATATATATATTTGGTTAGG - Intronic
1078640816 11:13094126-13094148 GTGTGTATATATATTGAAGGTGG + Intergenic
1078813840 11:14799623-14799645 GGGTACATATATATTTAGGATGG + Intronic
1079188183 11:18255756-18255778 ATGTATATATATATGTATATTGG + Intergenic
1079286007 11:19133370-19133392 GTGTGTATATATATGTGTGTGGG - Intronic
1079410550 11:20183420-20183442 GTGTATGTGTATATTTGGGAAGG + Intergenic
1079462844 11:20699326-20699348 GTGTATACATATATATACCTTGG - Intronic
1079520369 11:21319483-21319505 ATATATATATAAATTTAGCTGGG - Intronic
1079841906 11:25413748-25413770 ATATATATATATATATAGGCTGG + Intergenic
1080155224 11:29103107-29103129 ATGTATTTATTTATTTAGATGGG + Intergenic
1080315659 11:30945383-30945405 GTGCATATATATATATAACTTGG - Intronic
1080539076 11:33249556-33249578 GTATATATATATATATAAGCTGG - Intergenic
1080616413 11:33948541-33948563 GTATATATATATATTTAGTGTGG + Intergenic
1080929713 11:36797006-36797028 GTGTATGTGTATATTTTGGAGGG + Intergenic
1081139180 11:39476391-39476413 GTATATATATATATTTTTTTTGG + Intergenic
1081161008 11:39748351-39748373 GTATATATATATATCTGAGTTGG + Intergenic
1081332066 11:41815365-41815387 GTGTGTATGTATGTTTAGATGGG - Intergenic
1081346903 11:41998965-41998987 GTGTGTGTAGATAGTTAGGTAGG - Intergenic
1081390269 11:42520953-42520975 GTGTATATATGTATATATGTTGG + Intergenic
1081464958 11:43307945-43307967 ATGTATATATATATATATATTGG + Intergenic
1081511772 11:43781634-43781656 GTATATATATTTATTTTTGTAGG - Intronic
1081836764 11:46161851-46161873 TTATATATATATATATAGGCTGG - Intergenic
1081899262 11:46614129-46614151 ATATATATATATATATAGGCTGG + Intronic
1082135576 11:48545590-48545612 GGGTGCATATATATTTAGGATGG + Intergenic
1082557135 11:54576040-54576062 GGGTGCATATATATTTAGGATGG - Intergenic
1082752581 11:57035171-57035193 GTATATATATATATTTGGGAGGG - Intergenic
1082752583 11:57035175-57035197 GTGTGTATATATATATATTTGGG - Intergenic
1082921546 11:58500497-58500519 GTGTATATATATATAAAATTTGG + Intergenic
1084498481 11:69519945-69519967 ATATATATATATATATAGCTGGG + Intergenic
1084699484 11:70777098-70777120 GTGTAAATGCATATGTAGGTGGG - Intronic
1084732981 11:71085449-71085471 ATATATATATATATTTAAGATGG - Intronic
1084782842 11:71422345-71422367 AGGTATATATATATTTACATGGG - Intergenic
1085928219 11:81047842-81047864 GTATATATATATATGAAGATTGG - Intergenic
1085928222 11:81047993-81048015 GTGTATATATATATGAAGTTTGG - Intergenic
1085928223 11:81048038-81048060 GTGTATATATATATGAATATTGG - Intergenic
1085928225 11:81048128-81048150 GTATATATATATATGAAGATTGG - Intergenic
1085928227 11:81048220-81048242 GTGTATATATATATGAAGATTGG - Intergenic
1085928228 11:81048265-81048287 GTGTATATATATATGAATATTGG - Intergenic
1085928231 11:81048384-81048406 GTGTATATATATATGAAGATTGG - Intergenic
1085928232 11:81048429-81048451 GTGTATATATATATGAAGATTGG - Intergenic
1085928234 11:81048472-81048494 GTATATATATATATGAAGATTGG - Intergenic
1085928244 11:81048879-81048901 GTGTATATATATGTGAAGATTGG - Intergenic
1086052254 11:82607066-82607088 CTGTATATATATTTTTAAATAGG + Intergenic
1086057334 11:82662318-82662340 GTGTATATATATATATTTTTTGG - Intergenic
1086824810 11:91483540-91483562 GTATATATATATATATATGATGG - Intergenic
1086983504 11:93224320-93224342 ATGTATATACATATTTATATAGG - Intergenic
1087003211 11:93442731-93442753 GGGTGCATATATATTTAGGATGG + Intergenic
1087302575 11:96453163-96453185 GTGTATATATATATAGGGTTTGG + Intronic
1087457755 11:98408700-98408722 GTATAAATATATATTCAGATTGG - Intergenic
1087506918 11:99035461-99035483 GGGTGCATATATATTTAGGATGG + Intronic
1087759660 11:102092102-102092124 GTATATATATATATATATGCAGG - Intergenic
1087834049 11:102852437-102852459 ATATATATATATATATATGTTGG - Intergenic
1087859775 11:103139906-103139928 GAGTGCATATATATTTAGGATGG + Intronic
1087939019 11:104071387-104071409 GTGTATATATATATATAATATGG + Intronic
1088015844 11:105059018-105059040 TTTTATATATATATATATGTTGG + Intronic
1088032106 11:105263783-105263805 ATATATATATATATATATGTAGG - Intergenic
1088367260 11:109052764-109052786 GTATATATAGATATTTAAGAGGG + Intergenic
1088367613 11:109055730-109055752 GTATATTTATATATATACGTAGG - Intergenic
1088398672 11:109398620-109398642 GTGTGTATATATATATAGATAGG + Intergenic
1088589034 11:111386590-111386612 GTGTATATACATATTTTCCTTGG + Intronic
1088668422 11:112117825-112117847 ATGTATATATATATAAAGGTCGG - Intronic
1088945345 11:114506182-114506204 GGGTGTATATGTATTTAAGTTGG - Intergenic
1089714587 11:120345743-120345765 CTGTATATATATATATATTTAGG - Intronic
1090041106 11:123292348-123292370 GTGTATTTATATATTTAAGTTGG - Intergenic
1090705542 11:129333097-129333119 ATATATATATATATTTAGCCAGG + Intergenic
1091432045 12:444621-444643 GTGTATATTTTTATTTATCTTGG - Intergenic
1091578854 12:1767373-1767395 GAGTATATATATTTCTAGGCAGG + Intronic
1092311463 12:7359983-7360005 GGGAATGTATATATTTAGTTTGG + Intronic
1092316500 12:7421185-7421207 GTGTATATATGTATATATATGGG + Intronic
1092382393 12:8007833-8007855 GTGTATATATATATTTAAATAGG - Intergenic
1092582481 12:9858686-9858708 GTGTATATATATATGTATATAGG + Intronic
1092640586 12:10504485-10504507 ATATATATATATATATATGTTGG + Intergenic
1092758388 12:11786355-11786377 GCGTATATATATCTTTAATTAGG - Intronic
1092945152 12:13447195-13447217 ATGGATATATATATTTTGATAGG - Intergenic
1093017195 12:14166516-14166538 GTGCATATATATATATATATAGG + Intergenic
1093318164 12:17677605-17677627 GTGTATATTTGTATTTATGTGGG + Intergenic
1093544393 12:20329276-20329298 GTGCATATGAATATTTACGTGGG - Intergenic
1094121331 12:26977800-26977822 GTGTGTATACATATATAGGTAGG + Intronic
1094260827 12:28496944-28496966 ATATATATATATATATATGTAGG + Intronic
1094686153 12:32717493-32717515 GTATATATATATATTTTAGACGG + Intronic
1094686171 12:32718144-32718166 GTATATATATATATTTTAGATGG + Intronic
1094873319 12:34612199-34612221 GGGTGCATATATATTTAGGGTGG + Intergenic
1095051325 12:37557188-37557210 ATGTATATACAAATATAGGTTGG + Intergenic
1095054645 12:37584793-37584815 ATGTATATACAAATATAGGTTGG + Intergenic
1095228949 12:39712009-39712031 ATGTATATATACATACAGGTAGG - Intronic
1095228951 12:39712041-39712063 ATGTATATATACATACAGGTAGG - Intronic
1095245751 12:39919141-39919163 GTGTATACATATATGTATGCAGG - Intronic
1095661683 12:44743750-44743772 GGGTGCATATATATTTAGGCTGG - Intronic
1095687894 12:45056248-45056270 ATATATATATATATATATGTTGG - Intergenic
1095728871 12:45483052-45483074 TTATATATATATATTTATATGGG + Intergenic
1095805104 12:46310747-46310769 AGGTGTATATATATTTAGGATGG + Intergenic
1095856640 12:46867013-46867035 TTATATATATATATATATGTGGG + Intergenic
1095893449 12:47256826-47256848 GTGTATATATATATATCTGATGG + Intergenic
1095931713 12:47634650-47634672 GTGTATATACACATATATGTGGG + Intergenic
1096042758 12:48533032-48533054 TTATATATATATATTTTTGTGGG - Intergenic
1097296526 12:57970850-57970872 GTGTGTATATATATATGTGTAGG + Intergenic
1097334677 12:58369091-58369113 ATATATATATATATATATGTAGG + Intergenic
1097490785 12:60268445-60268467 GTGTGTATATATATGTATATGGG - Intergenic
1097968522 12:65607489-65607511 GTGTTTAGATATATTTATGTGGG + Intergenic
1098011874 12:66061838-66061860 ATATATATATATATATAGGAGGG + Intergenic
1098029676 12:66240815-66240837 TTTTATATATATATATATGTGGG - Intronic
1098581693 12:72107130-72107152 GTGTATGGATACATTAAGGTAGG - Intronic
1098627907 12:72695871-72695893 GTGTGTATATATATATATGGGGG - Intergenic
1098652543 12:72991310-72991332 ATGTATATATTTATGTATGTGGG + Intergenic
1098809509 12:75068487-75068509 GTGTACATAATTATTTAAGTAGG + Intronic
1098819941 12:75214336-75214358 ATGTATATATATATTTGAGATGG - Intergenic
1098895734 12:76058190-76058212 ATATATATATATATATATGTAGG - Intronic
1099248684 12:80225006-80225028 GTGTATATACATATATATATGGG - Intronic
1099294463 12:80812992-80813014 CTGTATATTTATTTTTATGTCGG - Intronic
1099445702 12:82748928-82748950 GTGTATCTCTATATATATGTGGG + Intronic
1099461663 12:82929579-82929601 GTGTTGAGATATATTTAGTTGGG - Intronic
1099516927 12:83608357-83608379 GTATATATGTATATATATGTAGG - Intergenic
1099730791 12:86498250-86498272 CTGTATATATCTGATTAGGTTGG - Intronic
1100066746 12:90656131-90656153 ATGTATATATATATATATATAGG + Intergenic
1100103824 12:91143882-91143904 GTGTATATATATAAATATGGGGG + Exonic
1100266499 12:92981338-92981360 GGGTGCATATATATTTAGGATGG - Intergenic
1100543598 12:95580636-95580658 GTGTCTATGTATATGTAGGTGGG + Intergenic
1100545414 12:95597471-95597493 TTATATATATATATGTAGCTGGG + Intergenic
1100874150 12:98944543-98944565 GTGTGTACATTTATTTTGGTAGG - Intronic
1100920821 12:99484675-99484697 AGGTGTATATATATTTAGGATGG + Intronic
1101357073 12:103990117-103990139 ATATATATATATATATATGTAGG + Intronic
1101907955 12:108841846-108841868 ATATATATATATATATAGCTAGG + Intronic
1102282862 12:111632250-111632272 ATGTATATATATATATATGTAGG + Intergenic
1102321615 12:111940460-111940482 GTATGTATATATATATATGTGGG - Intronic
1102423039 12:112819108-112819130 GTATATATATATATTTGAGATGG + Intronic
1102445746 12:113001341-113001363 GTATATATATATTTTTTGGTTGG - Intronic
1102749938 12:115283882-115283904 GTGTATATATATATATATCTGGG - Intergenic
1103148064 12:118612445-118612467 TTATATATATATATATAGCTGGG + Intergenic
1103218328 12:119221372-119221394 GTGTATATATATATTTTTTATGG - Intergenic
1103483639 12:121267815-121267837 ATGTATATAGATATTTAGGGAGG - Intronic
1103538038 12:121646885-121646907 ATGTATGTATATATTTATTTGGG - Intergenic
1104395293 12:128427424-128427446 GTGTGTATATATATTTAAGGAGG + Intronic
1105312618 13:19226395-19226417 GTGTATATATATATTTTTTGAGG - Intergenic
1105774483 13:23644829-23644851 GTGTATATATATATATATTTGGG + Intronic
1105788838 13:23776913-23776935 GTGTATATGTACATATATGTGGG - Intronic
1105873721 13:24534953-24534975 GTGTATATATATATGTATATGGG + Intergenic
1106200631 13:27533764-27533786 GTGTATATATATATATATACAGG - Intergenic
1106292020 13:28372586-28372608 ATATATATATATATATAGCTGGG + Intronic
1106352384 13:28945176-28945198 GTGTATATATATATATATAATGG - Intronic
1106610728 13:31277403-31277425 ATGTCTATTTATATTTAGGATGG - Intronic
1106700763 13:32225952-32225974 CTGTATAGAGATATTCAGGTTGG - Exonic
1106894418 13:34283056-34283078 ATATATATATATATTTATTTAGG + Intergenic
1107091348 13:36484400-36484422 GTGTATATATATATATATGTAGG - Intergenic
1107168767 13:37315205-37315227 GGGTGTATATATATTTAGGATGG + Intergenic
1107414177 13:40186062-40186084 GTGTATATATATATGTATGTTGG + Intergenic
1107650351 13:42538665-42538687 ATATATATATATATATATGTAGG - Intergenic
1107704165 13:43082843-43082865 GTGTGTATATATATATATATAGG - Intronic
1107704166 13:43082910-43082932 GTGTATATATATATGAAATTTGG + Intronic
1107975734 13:45687126-45687148 ATATATATATATATATATGTAGG + Intergenic
1108163048 13:47662792-47662814 GTGTATGTATGTATGTAGGCAGG - Intergenic
1108224973 13:48279951-48279973 ATGTACATATATATATATGTAGG + Intergenic
1108633083 13:52305381-52305403 GTGTATATATATATATATATAGG - Intergenic
1108651227 13:52481839-52481861 ATATATATATATATATATGTGGG + Intergenic
1108815963 13:54290421-54290443 ATGTATATTTATATTTTGGGGGG + Intergenic
1109008269 13:56906811-56906833 ATATATATATATATATATGTAGG + Intergenic
1109141441 13:58717493-58717515 ATATATATATATATTAAGTTTGG + Intergenic
1109321604 13:60817258-60817280 TTGAAAATATATATATAGGTAGG - Intergenic
1109349965 13:61166773-61166795 GTATATATATATAGGTAGATAGG - Intergenic
1109514304 13:63421635-63421657 TTGTAGGTATTTATTTAGGTTGG + Intergenic
1109550424 13:63890772-63890794 GTGTATATATATATATATCTGGG + Intergenic
1109567568 13:64137590-64137612 GTATATATATATATATATGATGG + Intergenic
1109755600 13:66755532-66755554 GTGGACATCTATATTTAGGTGGG - Intronic
1109774458 13:67021902-67021924 ATGTGTATATATATGTATGTAGG + Intronic
1109867600 13:68285791-68285813 GTGTATGTGTATATATATGTGGG - Intergenic
1110091809 13:71460143-71460165 GTGTAAATATTTAGTTTGGTAGG - Intronic
1110096303 13:71526706-71526728 GTATATATATATATATATATAGG + Intronic
1110110013 13:71734100-71734122 GTGTATATATATATGTATATGGG + Intronic
1110233094 13:73187123-73187145 GTGTGTATATATATATATGTAGG + Intergenic
1110353054 13:74532869-74532891 GTGTGTATATATATATATGAAGG - Intergenic
1110386872 13:74922739-74922761 ATTTATATACATATTTATGTGGG - Intergenic
1110469026 13:75837187-75837209 GGAAATTTATATATTTAGGTTGG - Intronic
1111032820 13:82628385-82628407 GTGTATATATGTATATATGCAGG - Intergenic
1111252896 13:85628007-85628029 ATATATATATATATATAGTTTGG - Intergenic
1111378950 13:87420393-87420415 GGGTATATACATATTTATATTGG + Intergenic
1111416900 13:87958530-87958552 GTGTATATATATGTGTGTGTGGG - Intergenic
1111502422 13:89139143-89139165 GTGTGTATATATATATAGATAGG - Intergenic
1111530826 13:89535875-89535897 GTATATATATATATATATATCGG + Intergenic
1111790452 13:92848655-92848677 GTCTATATATATCTTAAGCTGGG + Intronic
1111822608 13:93231425-93231447 GTATATATATATATATAGTCTGG + Intronic
1111883744 13:93992179-93992201 ATATATATATATATATATGTGGG + Intronic
1112104190 13:96222898-96222920 GTGTATATATATGTTTCAGTGGG + Intronic
1112181011 13:97080611-97080633 GTTTATTTATTTATTTAGATAGG + Intergenic
1112255649 13:97828394-97828416 ATATATATATATATTTCTGTTGG + Intergenic
1112347791 13:98605282-98605304 ATGTATATATATATTTGAGATGG - Intergenic
1112647042 13:101345758-101345780 ATATATATATATATTTAGAGAGG + Intronic
1112647491 13:101351004-101351026 GTATATACATATATGTATGTTGG - Intronic
1112818838 13:103307005-103307027 GTGTATATATATATGTATATAGG + Intergenic
1112841662 13:103586894-103586916 GTGTATATATATATATATAAAGG + Intergenic
1112899743 13:104344043-104344065 GGGTGCATATATATTTAGGATGG + Intergenic
1112907389 13:104441477-104441499 ATGTATCTATATATTTAGATAGG - Intergenic
1112934211 13:104779292-104779314 TTGTATATGTATTTTTAGTTTGG + Intergenic
1112945872 13:104926274-104926296 ATGTATATATATATATATGATGG + Intergenic
1113132894 13:107057895-107057917 GTATATATATATATATATATGGG - Intergenic
1113319331 13:109217501-109217523 ATATATATATATATTAAGCTGGG + Intergenic
1113601336 13:111570749-111570771 GTATATATATATATGGAGTTAGG - Intergenic
1114137798 14:19872464-19872486 GTGTATATATATATATAAATAGG - Intergenic
1114137800 14:19872526-19872548 GTGTATATATATATATAAATAGG - Intergenic
1114477157 14:23004202-23004224 ATATATATATATATTTTGGCCGG - Intronic
1114662555 14:24356794-24356816 ATTTATATATATATATAGGCTGG - Intergenic
1114852968 14:26402526-26402548 ATATATATATATATATATGTCGG - Intergenic
1114965572 14:27955286-27955308 TTTTATATATATATATATGTAGG - Intergenic
1115287619 14:31733169-31733191 GTTTATATATATAGATAGGTAGG + Intronic
1115341333 14:32295800-32295822 GTGTGTATATATATATATGAAGG - Intergenic
1115421516 14:33200238-33200260 TTATATGTCTATATTTAGGTTGG - Intronic
1115884933 14:37960575-37960597 GTATATATATATATTCATTTGGG - Intronic
1115958142 14:38805337-38805359 ATATATATATATATTAATGTTGG - Intergenic
1115970333 14:38938526-38938548 GTGAATATATATATATATGATGG + Intergenic
1116053888 14:39839471-39839493 GAGCATAAATATATTTATGTTGG + Intergenic
1116082159 14:40187901-40187923 GTGTAAAAATAGATGTAGGTCGG - Intergenic
1116115071 14:40637520-40637542 ATGTATATATATATGTATATTGG + Intergenic
1116132665 14:40877204-40877226 GTATATATATATATATATATGGG - Intergenic
1116133884 14:40895960-40895982 ATATATATATATATATAGTTGGG + Intergenic
1116305694 14:43253424-43253446 GTATAAAAATATAATTAGGTTGG - Intergenic
1116310255 14:43316558-43316580 TTATATATATATATTTAATTTGG - Intergenic
1116313929 14:43362457-43362479 GTGTGTATATAAATATAGATAGG - Intergenic
1116677939 14:47929189-47929211 GTGTATACATATATATGTGTGGG + Intergenic
1116981742 14:51178203-51178225 GTGTATATATATATTCATTATGG + Intergenic
1117551162 14:56837736-56837758 GTGCACATATATATTTATGTTGG + Intergenic
1117587265 14:57222693-57222715 GTATATATATATATATATGGGGG - Intronic
1117587267 14:57222695-57222717 GGGTATATATATATATATATGGG - Intronic
1117782198 14:59244726-59244748 GTGTGTGTGTGTATTTAGGTTGG + Intronic
1117915905 14:60677546-60677568 ATATATATATATATTTTGGCTGG - Intergenic
1118044463 14:61951793-61951815 GTATATATATATTTTAAGATAGG + Intergenic
1118297391 14:64583050-64583072 ATATATATATATATATAGCTGGG - Intronic
1119056833 14:71430968-71430990 GTGTATATGTATATCTATATAGG - Intronic
1119267402 14:73271265-73271287 TTATCTATATAAATTTAGGTAGG + Intronic
1119630967 14:76231891-76231913 TTATATATATATATTTATATGGG - Intronic
1120067870 14:80065722-80065744 ATGTATATTTATAGTTAGATAGG + Intergenic
1120120255 14:80670403-80670425 ATGTATATAAATAGGTAGGTAGG - Intronic
1120120256 14:80670407-80670429 GTGTATGTATATAAATAGGTAGG - Intronic
1120351947 14:83372718-83372740 GTGTATATAGATATGCAAGTGGG + Intergenic
1120354971 14:83420742-83420764 TTATATATATATATATATGTGGG - Intergenic
1120385366 14:83839080-83839102 TTGTGTATATATGTTTAGATGGG - Intergenic
1120484822 14:85099894-85099916 GTATATATATATATATATGTTGG + Intergenic
1120549220 14:85848634-85848656 GTGTATATATATATATATAAAGG + Intergenic
1120690980 14:87592309-87592331 GTATATACATATATATATGTAGG - Intergenic
1121349132 14:93159804-93159826 ATATATAAATATATTTAGCTGGG + Intergenic
1122436336 14:101702995-101703017 GTGGATAGATATAGATAGGTAGG - Intergenic
1122563544 14:102634694-102634716 GTGTATATATATATATTTTTTGG + Intronic
1122615532 14:103015323-103015345 GTGTATAAAAATAATTAGGCTGG + Intronic
1122833320 14:104415713-104415735 GGGTGCATATATATTTAGGATGG + Intergenic
1202843263 14_GL000009v2_random:143826-143848 GTATATATATATGTATAGGCTGG + Intergenic
1202912661 14_GL000194v1_random:134078-134100 GTATATATATATGTATAGGCTGG + Intergenic
1123568572 15:21578167-21578189 AAATATATATATATTTTGGTTGG + Intergenic
1123604681 15:22013489-22013511 AAATATATATATATTTTGGTTGG + Intergenic
1123839654 15:24235362-24235384 GTATATATATATATGGTGGTTGG + Intergenic
1124081686 15:26504743-26504765 AGGTAGAAATATATTTAGGTAGG - Intergenic
1125063473 15:35453276-35453298 GTGTATATATATATGGAAGAAGG - Intronic
1125064321 15:35463781-35463803 GTGTATATATATATATCCATAGG - Intronic
1125089860 15:35777583-35777605 GTGTGTATACATATATATGTAGG - Intergenic
1125180267 15:36874945-36874967 ATATATATATATATGTAGTTGGG + Intergenic
1125353967 15:38797456-38797478 GTGTATATATATATTTAAACTGG + Intergenic
1125382420 15:39101050-39101072 GTGTATATATAGAAATATGTAGG + Intergenic
1125793203 15:42385505-42385527 GTGTATATATATATATAATAGGG - Intronic
1125800146 15:42438515-42438537 TTCTATAAATATATTTAAGTAGG + Intronic
1125866285 15:43053133-43053155 GGAGATATCTATATTTAGGTTGG + Intronic
1125995449 15:44155582-44155604 ATGTATATATATATTTGGGGAGG - Intronic
1126217030 15:46167230-46167252 GTATATATGTATATTTCTGTTGG - Intergenic
1126267092 15:46767729-46767751 ATGTATAGATATATTTATCTTGG + Intergenic
1126460301 15:48907767-48907789 GTGTATATATATATATATGATGG - Intronic
1126469570 15:48993687-48993709 ATATATATATATATATAGCTTGG + Intronic
1126623182 15:50660645-50660667 GTATGTATATATTTTTAGGCTGG - Intronic
1126624540 15:50673629-50673651 GTATATATATATATATACGAGGG - Intronic
1126635207 15:50772832-50772854 ATATATATATATATATATGTTGG + Intergenic
1126980261 15:54234240-54234262 GTATATATATATATATATATGGG + Intronic
1127749530 15:62019943-62019965 ATGTATATATATATATAGGCTGG - Intronic
1128021428 15:64394238-64394260 ATGTATACATATTTTTAGTTCGG + Intronic
1128042830 15:64590686-64590708 ATGTATATATATATGTATCTGGG + Intronic
1128075839 15:64824948-64824970 GTGTATATATATATAGAAATTGG - Intronic
1128164274 15:65448910-65448932 ATATATATATATATTTAGCCTGG + Intronic
1128758951 15:70202131-70202153 GTGTATATATATGTGTGTGTGGG + Intergenic
1129001174 15:72335639-72335661 GTGTATATATATATATATGAAGG - Intronic
1129410138 15:75346208-75346230 GTGTATATATATATATATTTGGG + Intergenic
1129865356 15:78903388-78903410 GGGTATATACATATGTGGGTTGG + Intergenic
1130162695 15:81417406-81417428 GTGTGTATGTATATGTAAGTGGG - Intergenic
1130584453 15:85169753-85169775 ATATATATATATATATAGTTAGG + Intergenic
1130729552 15:86476531-86476553 GGGTGCATATATATTTAGGATGG - Intronic
1131069196 15:89454375-89454397 GTGTATATATATATATATGTTGG - Intergenic
1131484137 15:92806610-92806632 GTGTATGTATGTAAGTAGGTAGG + Intronic
1131610123 15:93951742-93951764 GGATATAGATATATGTAGGTAGG - Intergenic
1132401624 15:101511588-101511610 GTGTATATATATATATATATAGG + Intronic
1132401626 15:101511592-101511614 ATATATATATATATATAGGTGGG + Intronic
1132437009 15:101815407-101815429 TTTTATATATATATATATGTGGG + Intronic
1202976927 15_KI270727v1_random:305255-305277 AAATATATATATATTTTGGTTGG + Intergenic
1133796238 16:9048760-9048782 GTGTGTATATATATATAGAATGG + Intergenic
1133812493 16:9171495-9171517 GTCTATACATATAAATAGGTAGG + Intergenic
1134351865 16:13444977-13444999 ATATATATATATATATAGCTAGG - Intergenic
1134751086 16:16625690-16625712 AAATATATATATATTTAGCTGGG + Intergenic
1134994370 16:18727897-18727919 ATATATATATATATTTAGCTGGG - Intergenic
1135044192 16:19141399-19141421 GTGTATATATATATGTGTGTGGG - Intronic
1135208472 16:20503048-20503070 GTATATATATATATATAATTGGG + Intergenic
1135583135 16:23645074-23645096 ATATATATATATAGTTAGGCTGG - Intronic
1135583136 16:23645078-23645100 ATATATATATATATATAGTTAGG - Intronic
1136495520 16:30641109-30641131 CTATATATATATATTTTGGCTGG - Intergenic
1136495606 16:30641713-30641735 ATATACATATATATTTAGCTGGG + Intergenic
1137298002 16:47115735-47115757 GTATATATATATATTTTGTAGGG + Intronic
1137423013 16:48352343-48352365 CTATATATATATATTCAAGTGGG + Exonic
1137859146 16:51828892-51828914 GTGTATATATATGTATATATGGG - Intergenic
1137898209 16:52237058-52237080 GTGTATATATAAATATATGTGGG - Intergenic
1138201778 16:55094017-55094039 ATGTATGTATTTATTTAGGTTGG - Intergenic
1138375249 16:56558857-56558879 GTGTGTGCATATATTTGGGTTGG + Intergenic
1138755306 16:59476864-59476886 GTATATATATATATATATATTGG + Intergenic
1138848178 16:60593019-60593041 GTATATTTATGTATGTAGGTAGG + Intergenic
1138906741 16:61345229-61345251 GGGTATAAATATATTTATGTTGG - Intergenic
1138935819 16:61721103-61721125 GTGAATATATATATATTGGAGGG - Intronic
1139069899 16:63367635-63367657 ATGTATGTATAAATTTAGGCAGG + Intergenic
1139199427 16:64957633-64957655 GTATATATATATATATGGATGGG - Intronic
1139232068 16:65293246-65293268 GTGTATGTATATATATATATAGG + Intergenic
1139314106 16:66053490-66053512 ATGTATGTATATAGGTAGGTAGG - Intergenic
1139326803 16:66158868-66158890 GTATATATATATATAAAGATAGG - Intergenic
1139488752 16:67274569-67274591 GTGTGTATATATATATATATGGG - Intergenic
1139627288 16:68200400-68200422 GTTTATATATATATATATATGGG + Intronic
1140027970 16:71308780-71308802 GGGTGCATATATATTTAGGATGG - Intergenic
1140073370 16:71672930-71672952 GTGCATATATTTATGTAGATAGG - Intronic
1140458970 16:75123483-75123505 ATATATATATATATATATGTAGG + Intergenic
1140559581 16:75962619-75962641 GTGTTTTTATTTATTTAGCTTGG - Intergenic
1140563944 16:76018765-76018787 ATGTATATATATATTTACATTGG - Intergenic
1140612228 16:76614050-76614072 GTGTATATATATAATTTAATTGG - Intronic
1140862665 16:79032120-79032142 GTGTATATATATATTTGTTAGGG + Intronic
1140862741 16:79033204-79033226 GTGTATATATATATTTGTTAGGG + Intronic
1140937044 16:79682369-79682391 GTGTATATATATATTTATTGAGG + Intergenic
1141011911 16:80409322-80409344 GTATATATATACATATATGTGGG - Intergenic
1141126798 16:81406603-81406625 ATATATATATATATTTTGGCTGG - Intergenic
1141190089 16:81818333-81818355 GTGGTTATTTATATTTATGTGGG + Intronic
1141278757 16:82611373-82611395 GTATATATATATATATATATGGG - Intergenic
1141292840 16:82736253-82736275 TTATATAAATATATTTAGTTAGG - Intronic
1142543264 17:678625-678647 ATATATATATATATTTAGCCAGG - Intronic
1142778454 17:2161038-2161060 TTGTATGTATGTATGTAGGTAGG + Intronic
1143049446 17:4112025-4112047 ATATATATATATATTTAGACAGG - Intronic
1143072554 17:4308960-4308982 GTGAAAATTTATATTTAGGCAGG + Intronic
1143726759 17:8853187-8853209 TTTTAAATAAATATTTAGGTGGG + Intronic
1143929108 17:10402154-10402176 GTGTATATATATATATGGGTTGG + Intronic
1144066466 17:11628867-11628889 ATGTATGTATATATTTATTTTGG + Intronic
1144069525 17:11655600-11655622 GTGTGTATATATATATACATGGG - Intronic
1144222403 17:13112062-13112084 ATATATATATATATATAGCTGGG - Intergenic
1144228754 17:13177525-13177547 ATATATATATATATTTCAGTAGG - Intergenic
1144365044 17:14535459-14535481 ATATATATATATATATAGCTGGG - Intergenic
1145003811 17:19324333-19324355 GTCTAAATATATATTTAATTTGG - Intronic
1145096497 17:20033265-20033287 GTATATATATATTTTTTGGTTGG + Intronic
1145354346 17:22126118-22126140 TTGCATATGCATATTTAGGTTGG + Intergenic
1145371959 17:22314073-22314095 ATGTATATACAAATATAGGTTGG + Intergenic
1145375328 17:22342271-22342293 ATGTATATACAAATATAGGTTGG + Intergenic
1145396550 17:22500644-22500666 GGGTGCATATATATTTAGGGTGG + Intergenic
1146125894 17:30231310-30231332 GTGTGTATATATATATCTGTAGG - Intronic
1146135725 17:30319262-30319284 ATATATATATATATATAGCTGGG + Intronic
1146232453 17:31125316-31125338 TTGTATATATATATATATCTGGG + Intronic
1146250757 17:31341723-31341745 GTGTATATATATATGAACATGGG + Intronic
1146343166 17:32039469-32039491 ATATATATATATTTTTAGGCAGG - Intronic
1147061760 17:37885519-37885541 GTGTATATATATTTATATGTAGG - Intergenic
1147112262 17:38272013-38272035 ATATATATATATATATAGCTGGG - Intergenic
1147123128 17:38347847-38347869 ATATATATATATATTTACCTGGG - Intergenic
1147352852 17:39865423-39865445 GTGTGTATATATATTCAAGTGGG + Intergenic
1147501209 17:40965415-40965437 GTATTTATATAAATTTAGGATGG - Intronic
1147974994 17:44242194-44242216 ATATATATATATAATTAGCTGGG - Intergenic
1148280538 17:46343593-46343615 ATTTACATATAAATTTAGGTTGG + Intronic
1148302766 17:46561528-46561550 ATTTACATATAAATTTAGGTTGG + Intronic
1148641576 17:49192180-49192202 GTTTATTTATTTATTTACGTGGG - Intergenic
1149400060 17:56286865-56286887 GTGTATATATGTATATATTTGGG + Intronic
1149934778 17:60793760-60793782 GTGTATATATATATATATGATGG - Intronic
1150100945 17:62423366-62423388 GTGTGTATATATATTTTGGTTGG - Intergenic
1150399464 17:64845784-64845806 ATTTACATATAAATTTAGGTTGG - Intergenic
1150430837 17:65115692-65115714 ATGTATATATATATATATTTTGG - Intergenic
1150441531 17:65195483-65195505 ATGTATATATATATTTTTATTGG + Intronic
1150889655 17:69132849-69132871 ATGTATGTATATATGTATGTAGG - Intronic
1151057565 17:71051006-71051028 ATATATATATATATTTAAATAGG + Intergenic
1151075539 17:71268125-71268147 ATATATATATATATTTACATAGG + Intergenic
1151411842 17:73935827-73935849 GTGTATGTATATATTTATACAGG - Intergenic
1151595038 17:75073261-75073283 AAGTATATATATATATAGGCCGG - Intergenic
1151722752 17:75867125-75867147 ATATATATATATATTTGAGTTGG - Intergenic
1153167323 18:2277368-2277390 ATGTATATATATATATAATTAGG - Intergenic
1153259749 18:3212246-3212268 ATGTATATATTTTTGTAGGTAGG - Intronic
1153750688 18:8227175-8227197 GTGAATATATTTTATTAGGTTGG - Intronic
1153771255 18:8418277-8418299 GTAAGTATATATATTTAGGACGG - Intergenic
1154947512 18:21176878-21176900 GTGTGTATATATATATATTTTGG + Intergenic
1155034194 18:22010886-22010908 ATATATATATATATATAGGCTGG + Intergenic
1155467739 18:26157079-26157101 ATATATATTTATTTTTAGGTTGG - Intronic
1155768558 18:29669174-29669196 GTGTGTATATATATTTGAGATGG - Intergenic
1155997820 18:32350213-32350235 ATGTGTATATATATTTAGAGAGG - Intronic
1156011863 18:32505695-32505717 GTCTATACATATTCTTAGGTTGG + Intergenic
1156024594 18:32637670-32637692 GTGTGTATATATATATATATAGG - Intergenic
1156433336 18:37099766-37099788 GGGTGCATATATATTTAGGATGG + Intronic
1156434676 18:37113959-37113981 GGGTGCATATATATTTAGGATGG - Intronic
1156542519 18:37929067-37929089 GTGTATATATATATATACCATGG - Intergenic
1156879908 18:42064444-42064466 GTATATATATATATTTTAGAAGG - Intronic
1156973862 18:43192726-43192748 GTGTGTATATATATATATATGGG - Intergenic
1157049714 18:44148452-44148474 GTGGGTCTATATATTTAGTTAGG + Intergenic
1157050095 18:44153350-44153372 GAGAATTTATATAATTAGGTGGG + Intergenic
1158049315 18:53196714-53196736 GTGTATAAATATATATAGAACGG - Intronic
1158323180 18:56285510-56285532 GTGTATATAGATACATAGGAGGG - Intergenic
1158635939 18:59158054-59158076 GTGTATATATATATATTTTTTGG + Intronic
1158736914 18:60092672-60092694 TTATATATATATATTGAGCTGGG - Intergenic
1158881051 18:61779974-61779996 ATATATATATATATATATGTAGG - Intergenic
1159290356 18:66410729-66410751 GTGAATATATATTTTTAGCTTGG - Intergenic
1159363796 18:67439476-67439498 GTATGTATATGTATTTATGTAGG - Intergenic
1159588266 18:70302743-70302765 GTGTATATATATATACAGTTAGG - Intronic
1159665663 18:71156940-71156962 GTCAATATATATATATAGCTAGG - Intergenic
1159714331 18:71803261-71803283 GTGTATATATATATTCACAGAGG + Intergenic
1159848821 18:73501146-73501168 GTTTCTATAAATATATAGGTGGG - Intergenic
1160360842 18:78276577-78276599 GTGTATATATATATATATACAGG - Intergenic
1161425825 19:4202564-4202586 GTATATATATATATTTTAGATGG - Intronic
1162055195 19:8058952-8058974 ATATATTTATATATTTAGGCTGG - Intronic
1162414305 19:10525458-10525480 GTGTATATATATATATATGCAGG + Intergenic
1162696431 19:12480008-12480030 ATATATATATATAATTAGGTGGG + Intronic
1162816452 19:13198126-13198148 TTAAATATAAATATTTAGGTGGG - Intergenic
1164252228 19:23488853-23488875 GTGTATATATATATATATGTTGG + Intergenic
1164501674 19:28825416-28825438 GTGTATATATATATATATAAAGG - Intergenic
1164578977 19:29422659-29422681 GTGTATATATATATGTGGTGGGG - Intergenic
1165572852 19:36790248-36790270 ATGTATATACAAATATAGGTTGG - Intergenic
1165621714 19:37253576-37253598 ATATATATATATATATATGTTGG + Intergenic
1165641601 19:37393416-37393438 GTGGGTATATATATGTAGTTTGG - Intergenic
1165763336 19:38335547-38335569 ATATATATATATATTTGGGTAGG + Intergenic
1166008151 19:39921428-39921450 GTGTAAATATATCTAAAGGTAGG - Intronic
1166120180 19:40681660-40681682 ATATATATATATATTTAAATGGG - Intronic
1166878410 19:45912306-45912328 GTATATATATAAAATTAGGCAGG + Intergenic
1166909303 19:46140240-46140262 ATATATATATATATATAGGCTGG - Intergenic
1167020264 19:46869294-46869316 GTGTATATATATAGTTGGCCAGG + Intergenic
1168014346 19:53559722-53559744 GTGTATATGTGTATATATGTAGG - Intronic
1168081459 19:54013286-54013308 GTATATATATATATATATGTTGG - Intergenic
1168279325 19:55295961-55295983 ATATATATATATTTTTAGATAGG - Intronic
925029745 2:641056-641078 GTGTATATATGTGTTCATGTGGG - Intergenic
925067517 2:939986-940008 ATATATATATATATTTAAGGGGG + Intergenic
925340934 2:3135438-3135460 ATATATATATATATTTATGATGG - Intergenic
925451852 2:3975862-3975884 GTTTACATATATATGTGGGTGGG - Intergenic
925540887 2:4966685-4966707 GTGTATATATATATATATACCGG - Intergenic
925681529 2:6427080-6427102 GTGTATATAGACATGGAGGTGGG + Intergenic
925922936 2:8649476-8649498 ATGTATATATATATGTGTGTAGG + Intergenic
926272934 2:11380729-11380751 ATATATACATATATTTAGGCAGG + Intergenic
926794861 2:16610893-16610915 ATATATATATATATATATGTTGG - Intronic
926866787 2:17368681-17368703 GTGAATATATATATATATTTAGG + Intergenic
927298648 2:21484645-21484667 GTATATATATATATTTAGACAGG - Intergenic
927994890 2:27477695-27477717 GTGGAAAGATATATTTATGTAGG + Intronic
928073862 2:28244975-28244997 GCGTATATATATATTTATTGTGG + Intronic
928499446 2:31874913-31874935 GTGTACATATATATATACATAGG + Intronic
928692585 2:33816297-33816319 GTGTATACGTATATTTATATAGG - Intergenic
928810396 2:35217876-35217898 GTGTGTATATATATTAACATAGG - Intergenic
928889171 2:36182080-36182102 ATATAGATATATATATAGGTGGG + Intergenic
928889174 2:36182116-36182138 ATATAGATATATATATAGGTGGG + Intergenic
928889177 2:36182152-36182174 ATATAGATATATATATAGGTGGG + Intergenic
928889180 2:36182188-36182210 ATATAGATATATATATAGGTGGG + Intergenic
928889183 2:36182224-36182246 ATATAGATATATATATAGGTGGG + Intergenic
928889186 2:36182260-36182282 ATATAGATATATATATAGGTGGG + Intergenic
928889227 2:36182736-36182758 ATATATAGATATATATAGGTGGG + Intergenic
928889230 2:36182770-36182792 ATATATAGATATATATAGGTGGG + Intergenic
928889233 2:36182804-36182826 ATATATAGATATATATAGGTGGG + Intergenic
928889345 2:36184813-36184835 GTATATAGATATATATAAGTAGG + Intergenic
929121622 2:38488660-38488682 ATATATATATATTTTTAGGCAGG + Intergenic
929335678 2:40742090-40742112 GTATATATATATATATATGATGG + Intergenic
929375979 2:41287736-41287758 ATGTACATATACATTTATGTTGG - Intergenic
929602261 2:43211744-43211766 GTGTATAAATATTTGTAGATAGG + Intergenic
929741256 2:44603027-44603049 GTGTGTGTGTATATATAGGTTGG - Intronic
930143718 2:47979980-47980002 GTGTGTATATATATATATGAAGG + Intergenic
930301749 2:49624559-49624581 ATATATATATATATTTAGAGAGG - Intergenic
930409064 2:51000378-51000400 TTGTATGGATATATTCAGGTGGG - Intronic
930496687 2:52154180-52154202 GTGTGTATATATATATATGTGGG + Intergenic
931041595 2:58306369-58306391 GTGTATATATGTATGTGTGTGGG - Intergenic
931084093 2:58809729-58809751 ATAAATATATATATTTAGCTAGG + Intergenic
931121069 2:59220417-59220439 ATATATATATATATTTAGTCTGG - Intergenic
931431711 2:62213831-62213853 GTGTATATATATATATAATCTGG + Intronic
931909502 2:66882298-66882320 GTGTAAATATATATTAATGATGG + Intergenic
932377325 2:71249106-71249128 GGGTGCATATATATTTAGGATGG + Intergenic
932503624 2:72207444-72207466 TAGTACATATATAATTAGGTAGG + Intronic
932861956 2:75303664-75303686 GTGGATATATATGTATATGTGGG + Intergenic
933208800 2:79541326-79541348 GTGTATATATATATATATATAGG - Intronic
933431490 2:82185811-82185833 GTGTATATATATATATAAAAGGG - Intergenic
933798388 2:85940131-85940153 GTGAACATATATATTTTGATTGG - Intergenic
933903945 2:86870728-86870750 TTGTAGTTATATATTTAGGTGGG + Intergenic
933950778 2:87327325-87327347 ATATATATATATCTTTAGGCTGG + Intergenic
934928532 2:98399975-98399997 GTGTGTATGTATATATATGTTGG + Intergenic
935014308 2:99165426-99165448 GTGTATATCAAAAGTTAGGTTGG + Intronic
935028489 2:99299899-99299921 GTGTGTGTATATATGTAGGGAGG - Intronic
935058113 2:99585290-99585312 GTTTATATATATATTCAAGTTGG + Intronic
935073458 2:99716584-99716606 ATATATATATATATATAGGCTGG + Intronic
935317729 2:101853328-101853350 GTGTGTATATGTATATATGTAGG - Intronic
935429482 2:102959636-102959658 GTGTCTAAAAATCTTTAGGTTGG + Intergenic
935551239 2:104458005-104458027 GTGTGTATTTTTATTTAGTTAGG + Intergenic
935611179 2:105027297-105027319 CCGTATATATTTATTTAGCTGGG + Intergenic
935776564 2:106478245-106478267 TTGTAGTTATATATTTAGGTGGG - Intergenic
936227134 2:110665642-110665664 GTGTATATATGTATATATGAAGG - Intronic
936238139 2:110763496-110763518 GTCTATGTATAGATTTATGTGGG - Intronic
936328999 2:111531253-111531275 ATATATATATATCTTTAGGCTGG - Intergenic
936368290 2:111881406-111881428 TTGTAGTTATATATTTAGGTGGG - Intronic
936655233 2:114477525-114477547 GTATATATATATATGTATATTGG + Intronic
936851187 2:116900052-116900074 GTATATATATATATATATGATGG - Intergenic
936983811 2:118289194-118289216 GTGTGTATATATATGTCAGTGGG + Intergenic
937143450 2:119621343-119621365 GGGTGCATATATATTTAGGATGG - Intronic
937433612 2:121861875-121861897 GTGTATATATATATATACACAGG + Intergenic
937457987 2:122060184-122060206 GTGTATATATATATATAAATAGG + Intergenic
937525635 2:122765804-122765826 ATATATATATATATATATGTAGG - Intergenic
937747579 2:125433103-125433125 GTGTAAATATCTATATAAGTTGG + Intergenic
937775651 2:125772524-125772546 ATGTATGTATATATTTATATAGG + Intergenic
937852982 2:126652027-126652049 CTGTATATATATATATAGTGTGG + Intergenic
937859066 2:126694105-126694127 ATGTATATATATATTTACCCAGG - Intronic
938417889 2:131119542-131119564 GTTTATATATATATCTGTGTTGG + Intronic
938979176 2:136509308-136509330 GTGTATATATATATATAAAATGG + Intergenic
939435486 2:142171622-142171644 GTGTATATATATATATTGCTTGG - Intergenic
939677685 2:145092939-145092961 GTATATATATATATATATATAGG - Intergenic
939699187 2:145368686-145368708 GTGTGGATATATATATATGTGGG - Intergenic
939993082 2:148894706-148894728 ATATATATATATATATAGGGTGG + Intronic
940155764 2:150654890-150654912 TTTTATATATATATATATGTAGG + Intergenic
940181988 2:150944248-150944270 GTGTATATATATACTTGGAGGGG + Intergenic
940606336 2:155927722-155927744 ATGTATATATATATATATATAGG + Intergenic
940708134 2:157129100-157129122 GGGCATGTATATATTTAGGATGG - Intergenic
940784134 2:157964086-157964108 GTGAATATATATATATATGATGG - Intronic
940896974 2:159090211-159090233 GTGTATCTACATATGTATGTAGG - Intronic
940968838 2:159871797-159871819 GTGTATATATGTATATATGCAGG + Intronic
941088298 2:161144988-161145010 GGGTGCATATATATTTAGGATGG + Intronic
941172854 2:162161027-162161049 ATATATATATATATATATGTAGG + Intergenic
941219759 2:162762293-162762315 GTGTATATATATATACATATAGG + Intronic
941318093 2:164019799-164019821 GAGTATATATATATATATGATGG - Intergenic
942033769 2:171990550-171990572 ATGTATATATAAAATTAGCTGGG - Intronic
942271589 2:174281035-174281057 ATATATATATATATTTCAGTGGG + Intergenic
942272279 2:174288402-174288424 GGGTGCATATATATTTAGGATGG - Intergenic
942339940 2:174933180-174933202 GTGTATATATATAGGTATATAGG + Intronic
942405824 2:175653784-175653806 GTGTATATATATATATACCATGG + Intergenic
942417048 2:175770577-175770599 TTGTAAATATCTATTTAGGCCGG + Intergenic
942497192 2:176552130-176552152 GTGTATATATATATATATGATGG - Intergenic
942937752 2:181578238-181578260 GTGTGTATATATATGTGTGTGGG + Intronic
943245673 2:185447739-185447761 GTGTATATATATATTTATGCAGG + Intergenic
943276893 2:185878753-185878775 GGGCACATATATATTTAGGATGG - Intergenic
943373933 2:187052309-187052331 GTGTGCATATATATTTAGGATGG + Intergenic
943429758 2:187784502-187784524 TTATATATATATATTTATGATGG - Intergenic
943525617 2:189013438-189013460 GTGTATATATATGTATATGTAGG - Intergenic
943728853 2:191280720-191280742 GTGAATAGATATATTTGGTTGGG - Intronic
943992942 2:194720801-194720823 GTATATATATATATATACCTCGG + Intergenic
944204805 2:197146414-197146436 ATATTTATATATATTTAAGTTGG - Intronic
944315494 2:198281003-198281025 GTGTATAGATATATATATTTGGG - Intronic
944359417 2:198835226-198835248 GTGTATTGAAATATTTAGGAGGG + Intergenic
944552295 2:200855628-200855650 GTGTATATATATAATTTTTTGGG - Intronic
944794057 2:203164244-203164266 ATATATATATATTTTTAGATGGG - Intronic
945117601 2:206423670-206423692 ATATATATATATATTTAGAATGG + Intergenic
945449991 2:209982937-209982959 GTGTATATATATATATACATGGG - Intronic
945718346 2:213386312-213386334 AAATATATATATATTTTGGTTGG + Intronic
945927661 2:215821783-215821805 GGGTGCATATATATTTAGGATGG - Intergenic
946696629 2:222366412-222366434 GGGTGCATATATATTTAGGATGG + Intergenic
946743835 2:222826677-222826699 ATATATATATATATATATGTTGG - Intergenic
946937202 2:224734579-224734601 GTGTATATATATATATATGGAGG + Intergenic
947002320 2:225470821-225470843 GTGTGTATATATATTGAGATGGG + Intronic
947515424 2:230800032-230800054 GTGTATATATGTATTTTCTTTGG - Intronic
947947355 2:234117188-234117210 GTGTGTGTATATATATATGTAGG + Intergenic
948146202 2:235709977-235709999 GTGTATGTTTATATTTATGTAGG + Intronic
948674805 2:239590674-239590696 GTGTATATATATGTTTGTGTGGG - Intergenic
1168782257 20:503110-503132 GTGTGTATATATACATACGTTGG - Intronic
1169545555 20:6647018-6647040 ATGTATATGTTTATTTAGATAGG - Intergenic
1169758921 20:9069487-9069509 GTGTATATGATTATTTTGGTTGG + Intronic
1169833362 20:9850586-9850608 ATGTATATGTATATGTATGTAGG - Intergenic
1169932079 20:10844439-10844461 GGGTATATATGTATGTATGTAGG - Intergenic
1170166708 20:13367076-13367098 TTTTATATAAATATTTAGCTAGG + Intergenic
1170195567 20:13685617-13685639 GTATATATATATATATACATAGG + Intergenic
1170255494 20:14338367-14338389 GTGTATATATATACATATATTGG - Intronic
1170393286 20:15898980-15899002 GTGCATATATATATGTGTGTAGG + Intronic
1170444355 20:16409944-16409966 ATATATATATATATATATGTAGG - Intronic
1170444356 20:16409975-16409997 ATATATATATATATATATGTAGG + Intronic
1170444371 20:16410259-16410281 GTGTACATATATATATATGTAGG + Intronic
1170754118 20:19183032-19183054 GTTTATATATATATATATCTAGG + Intergenic
1170900588 20:20458855-20458877 GTATATATATATATATATATAGG - Intronic
1170970086 20:21107313-21107335 AGGTATATATATTTTTAAGTTGG - Intergenic
1171527607 20:25827513-25827535 ATGTATATACAAATATAGGTTGG - Intronic
1171549219 20:26028371-26028393 ATGTATATACAAATATAGGTTGG + Intergenic
1172547888 20:35775805-35775827 GTGTGTATATATATATATTTTGG + Intronic
1172547890 20:35775809-35775831 GTATATATATATATTTTGGGTGG + Intronic
1172890688 20:38261598-38261620 GTGTATATATGTATATATATAGG - Intronic
1172890689 20:38261620-38261642 GTGTATATATGTATATATATAGG - Intronic
1172968432 20:38855903-38855925 ATATATATATATATATATGTAGG - Intronic
1173095252 20:40021220-40021242 ATATATATATATATTTAGATGGG - Intergenic
1173379050 20:42521047-42521069 ATGTATGTATATAGGTAGGTGGG - Intronic
1173379052 20:42521051-42521073 ATGTATGTATGTATATAGGTAGG - Intronic
1173686398 20:44926519-44926541 ATATATATATATATGTAGGCTGG - Intronic
1173706329 20:45112938-45112960 GTGTATGTATCTATGTGGGTAGG - Intronic
1173764729 20:45597049-45597071 GTGTATATATATTTTTATCCTGG - Intergenic
1174347792 20:49943817-49943839 GTGTGTATATATATATAGCTGGG - Intronic
1174876285 20:54229967-54229989 GTCTCTATATATGTTTAGATTGG - Intergenic
1174960295 20:55148717-55148739 TTCTCTAAATATATTTAGGTTGG + Intergenic
1175023049 20:55872014-55872036 GTGTATATATATATATATAAAGG + Intergenic
1175356817 20:58375235-58375257 ATATATATATATATTTGGGGAGG - Intergenic
1175959656 20:62629237-62629259 GTGTGTATATATATATAAATAGG + Intergenic
1176137680 20:63531452-63531474 ATATATATATATAATTAGCTGGG + Intronic
1176632021 21:9148750-9148772 GTATATATATATGTATAGGCTGG + Intergenic
1176641282 21:9306071-9306093 ATATATATATATATATAGGCTGG - Intergenic
1176881382 21:14198567-14198589 GGGTACATATATATTTAGGATGG - Intronic
1176995367 21:15549192-15549214 GTGTGTATATAGATTTAAGATGG - Intergenic
1177052362 21:16252631-16252653 ATGTATATAGATATGTATGTGGG + Intergenic
1177058496 21:16339957-16339979 GGTTATATATATATTTATATAGG + Intergenic
1177058497 21:16339980-16340002 TTATATATATATATTTATATAGG + Intergenic
1177399679 21:20586786-20586808 GGGTATATATATATATATCTGGG - Intergenic
1177399793 21:20587896-20587918 GTGTGTATATATATATATGGGGG + Intergenic
1177409746 21:20714162-20714184 GGGTATATATATATATATGAAGG - Intergenic
1177525491 21:22285672-22285694 CTGTATATATATATCTATATAGG - Intergenic
1177607653 21:23402040-23402062 GTGTATATATATATTTGAGACGG - Intergenic
1177722213 21:24922039-24922061 GTGTATATATATATTTATGGTGG + Intergenic
1177912724 21:27052285-27052307 GTGTATATATATATATAAAGGGG - Intergenic
1177996082 21:28099727-28099749 GTGTATATATATATAAAATTTGG - Intergenic
1177996152 21:28101186-28101208 GTGTCTATGTATGTTTACGTGGG + Intergenic
1178013483 21:28314869-28314891 ATATATATCTATATATAGGTAGG - Intergenic
1178017477 21:28365955-28365977 GTGTATATATATATATAAAATGG - Intergenic
1178377486 21:32079374-32079396 ATGAATATATATAGTTAGTTTGG + Intergenic
1178910922 21:36672815-36672837 GTGTATACATATATATATATAGG - Intergenic
1179303797 21:40136588-40136610 GTGTGTATATATCTGTAGGGAGG - Intronic
1179357578 21:40674998-40675020 GTGTGTTTATATAATGAGGTGGG - Intronic
1179644049 21:42764833-42764855 GTATATATATATATTTTTTTGGG - Intronic
1179933525 21:44588783-44588805 GTGTGTATATATATATATGATGG + Intronic
1179947787 21:44689727-44689749 ATATATATATATATTTTGGGGGG + Intronic
1181193927 22:21167512-21167534 ATGTATATATATATATAATTTGG - Intergenic
1181527456 22:23498257-23498279 GTGTGTATATATATATATATAGG - Intergenic
1181863685 22:25839280-25839302 GTGTATATATATTTTCATGGAGG + Intronic
1181899490 22:26141296-26141318 GTATATATGTATATATATGTGGG - Intergenic
1182661916 22:31931216-31931238 GTGTATATATATATATAAAGGGG - Intergenic
1182675705 22:32037613-32037635 GTATATATATATATATATGATGG + Intergenic
1182936382 22:34226359-34226381 ATGTATATTTATATTTATGATGG + Intergenic
1182948255 22:34345546-34345568 GTGTATATATTTATTTGAGACGG + Intergenic
1184491707 22:44813504-44813526 GTGTATATGTATGTGTATGTAGG - Intronic
1184824769 22:46942136-46942158 GTGTGTATATATATGTATGCTGG - Intronic
1185026377 22:48415919-48415941 GTATATATAAATATATATGTAGG - Intergenic
949225851 3:1694712-1694734 GTTTATATCTACATTTATGTAGG - Intergenic
949285627 3:2400340-2400362 ATATATATATATATGTGGGTGGG + Intronic
949427073 3:3929139-3929161 GTGTATATATACATATATGAAGG - Intronic
949453274 3:4211101-4211123 GTATATATATATATATATATGGG - Intronic
949529453 3:4939910-4939932 AGGCATATATATTTTTAGGTTGG + Intergenic
949601427 3:5602398-5602420 GGATGAATATATATTTAGGTAGG - Intergenic
949866670 3:8552989-8553011 ATGTATGTATTTATTTATGTGGG + Intronic
950069910 3:10143451-10143473 ATGTATATATATTTTTGAGTTGG + Intronic
950255015 3:11497379-11497401 ATATATATATATATTTAGCCAGG + Intronic
950588578 3:13917179-13917201 GTGTATTTTTATATATTGGTGGG - Intergenic
951083281 3:18478167-18478189 GTGTATATATAGATATATATAGG - Intergenic
951400474 3:22227162-22227184 GTGTATATATATGTGTATGTGGG + Intronic
952006926 3:28851842-28851864 GTATATATATATATATGGTTTGG - Intergenic
952012877 3:28921326-28921348 TAATATATATATTTTTAGGTTGG - Intergenic
952121321 3:30248083-30248105 ATATATATATATATTTAGCTAGG + Intergenic
952182064 3:30927734-30927756 GTGTGTCTATATATTAATGTAGG - Intergenic
952203697 3:31157782-31157804 GTATGTATATATATTTTGCTAGG + Intergenic
952455833 3:33471131-33471153 GTGTATTAATATATTCAGGGAGG + Intergenic
953291895 3:41673669-41673691 ATGTATATATATATATATTTAGG - Intronic
953475072 3:43198640-43198662 GTGTATAAATATATTTTGGTTGG - Intergenic
954488655 3:50879580-50879602 GGGTGAATATATATTTAGGCTGG - Intronic
954631287 3:52048996-52049018 GTGTGTGTATATATATACGTAGG + Exonic
954723611 3:52587889-52587911 GTGTATATATATATATATGAGGG - Intronic
954860005 3:53679970-53679992 GTATATATAAATGTTTAGCTAGG - Intronic
954929168 3:54265672-54265694 GTGTGTATATATATATAGTGTGG + Intronic
955126895 3:56121753-56121775 GTGTATATATATTTTAAACTAGG + Intronic
955191743 3:56768048-56768070 ATATATATATATATTGAGGCTGG - Intronic
955323694 3:57993397-57993419 GTGTATATACATACATGGGTGGG - Intergenic
955362388 3:58286868-58286890 ATGTATATGTATATATAAGTAGG + Intronic
955659229 3:61278651-61278673 GTATATATATATATATATGAAGG - Intergenic
956026835 3:64992184-64992206 ATTGAGATATATATTTAGGTGGG + Intergenic
956031035 3:65038255-65038277 GTGTATATATATACATAAATAGG + Intergenic
956147759 3:66208744-66208766 GTGTATATATATATTTATATGGG + Intronic
956585275 3:70857722-70857744 ATGTATATGTATATATATGTGGG - Intergenic
956594646 3:70952828-70952850 GTGTATATATATATATATTTTGG + Intergenic
956866257 3:73372151-73372173 GGGTGCATATATATTTAGGATGG + Intergenic
956888007 3:73579840-73579862 GTGTGTATATATATTTATATGGG + Intronic
957114570 3:76008890-76008912 ATGTATATTTATGCTTAGGTTGG + Intronic
957175700 3:76805486-76805508 GTGTGTATATATATATATGGGGG - Intronic
957308537 3:78489452-78489474 GGGTGCATATATATTTAGGATGG - Intergenic
957393216 3:79606031-79606053 GTATATATATATATATATGTGGG - Intronic
957458368 3:80483494-80483516 GTGTATATATATATGTACATAGG - Intergenic
957468351 3:80624942-80624964 GTATATATATATGTTTCTGTGGG + Intergenic
957471518 3:80664353-80664375 GTATATATGTATATATATGTAGG + Intergenic
957635803 3:82782686-82782708 GAATATATATATATTTAGTATGG - Intergenic
957793742 3:84974233-84974255 GTATATATATATATATACTTTGG + Intronic
957838232 3:85628504-85628526 GTATATATATATATGTATATGGG - Intronic
957883761 3:86255999-86256021 GTTTATATTTTTCTTTAGGTTGG + Intergenic
957888974 3:86330091-86330113 GTGTATGTATATATATATATAGG - Intergenic
957954494 3:87167333-87167355 CTGTATATATACATATAGATAGG - Intergenic
958064549 3:88526675-88526697 GGGTACATATATATTTAAGATGG + Intergenic
958105357 3:89065687-89065709 GTGTAAATATATATATATTTTGG + Intergenic
958155819 3:89754515-89754537 GTGTAAGTACATATGTAGGTAGG - Intergenic
958258670 3:91353693-91353715 GTATATATATATATATATCTTGG + Intergenic
958559410 3:95725556-95725578 AAGTATATATATATATAGGTGGG + Intergenic
958910782 3:99991894-99991916 GTGTATATATATACATATATAGG + Intronic
958932316 3:100220421-100220443 GTATATATATATTTTTTTGTTGG - Intergenic
959188862 3:103083741-103083763 GTGTATATATATATATTTGCTGG + Intergenic
959336689 3:105076167-105076189 ATTTATTTATTTATTTAGGTTGG + Intergenic
959360654 3:105386653-105386675 ATATATATATATATTTATGGTGG - Intronic
959743104 3:109744249-109744271 ATATATATATATATTTTTGTAGG + Intergenic
959790948 3:110360367-110360389 GTGTATATATATATGGAACTTGG + Intergenic
959854964 3:111141959-111141981 ATGTATATGTTTATTTGGGTTGG + Intronic
959916502 3:111822315-111822337 GTGTATATATATATATATAATGG + Intronic
959960304 3:112290742-112290764 GAGTGGATATATATTTAGTTAGG + Intronic
959998550 3:112705537-112705559 GTGTATATATACATATATGATGG + Intergenic
960380685 3:116956937-116956959 GTGTATATATGTATATCTGTAGG - Intronic
960552431 3:118990864-118990886 GTATGTATATATGTGTAGGTAGG + Intronic
961057012 3:123797885-123797907 GTCTATATCTATATTCAGGGTGG - Intronic
961252033 3:125515363-125515385 ATATATATATATTTTTGGGTCGG + Intronic
961416019 3:126757600-126757622 GTGCATAGATATCTTGAGGTAGG + Intronic
961747550 3:129074633-129074655 GTGTGTATATATACATATGTGGG + Intergenic
961747552 3:129074637-129074659 GTATATATACATATGTGGGTGGG + Intergenic
961796431 3:129412206-129412228 GTGTATATATATTTTTGGGGGGG - Intronic
961803740 3:129473491-129473513 GTGTGTATATATGTTTAAGCAGG + Intronic
962166744 3:133057469-133057491 ATATATATATATATATATGTGGG + Intronic
962258736 3:133889432-133889454 ATATATATATATATTTATTTTGG + Intronic
962451756 3:135524638-135524660 GGGTATATATACATTTATTTTGG - Intergenic
962867447 3:139459460-139459482 ATATATATATATATTTAGCCAGG + Intronic
963085454 3:141431342-141431364 ATATATATATATATTTGGGGGGG + Intronic
963379693 3:144512395-144512417 GTGCATATATGTATATATGTGGG - Intergenic
963401017 3:144799615-144799637 ATATATATATATATGTATGTTGG + Intergenic
963403312 3:144830056-144830078 GTATATATATTTATATATGTAGG - Intergenic
963447340 3:145429163-145429185 GTGTATATATATATATATTTGGG - Intergenic
963512187 3:146260496-146260518 ATATATATATATATGTTGGTAGG - Intergenic
963917305 3:150870918-150870940 ATATATATATATTTTTTGGTGGG + Intergenic
964049928 3:152378476-152378498 CTCTCTATATTTATTTAGGTAGG + Intronic
964060181 3:152512625-152512647 GTGTATATATATATATAGTAGGG - Intergenic
964285795 3:155116588-155116610 GAGTATATATATATATATATTGG + Intronic
964418581 3:156476504-156476526 GTGTATATATATATATATGATGG - Intronic
964573385 3:158137395-158137417 ATATATATATATATTTAATTGGG - Intronic
964598289 3:158464245-158464267 GTGTATTTTTATATTTAATTTGG + Intronic
964618848 3:158700223-158700245 GTATATATATATATATAAATTGG + Intronic
964629129 3:158790471-158790493 GTAAATATATATTTTTATGTTGG - Intronic
964896687 3:161605307-161605329 GTGTATATATATATACATATGGG - Intergenic
964975727 3:162617448-162617470 ATGTATACATATATTTGGGTTGG + Intergenic
965013853 3:163131110-163131132 GTGTATATATATATATGTATGGG + Intergenic
965194348 3:165574640-165574662 GGGTGCATATATATTTAGGATGG - Intergenic
965245413 3:166260693-166260715 GTGTATATATATATTTATCCAGG + Intergenic
965285160 3:166810540-166810562 GTGGGTATATATATTTACATGGG + Intergenic
965369843 3:167848237-167848259 CTGTTGATAAATATTTAGGTTGG + Intergenic
966154512 3:176901558-176901580 GTGTATATATTTACATATGTAGG + Intergenic
966245069 3:177798823-177798845 ATATATATATATATTTATGTTGG + Intergenic
966440256 3:179937064-179937086 ATGTATATATATATATATGAGGG - Intronic
966447938 3:180024339-180024361 ATATATATATATATTTAGTAGGG - Intronic
966450515 3:180054542-180054564 ATATATATATACATTTATGTTGG - Intergenic
967209540 3:187155919-187155941 GTATATATATATATATATGATGG + Intronic
967374478 3:188785531-188785553 GTGTGTATATATATATATGATGG - Intronic
967466247 3:189809116-189809138 ATGTATATATTTATTTAATTTGG + Intronic
968349537 3:198041992-198042014 GTATATATATTTATTAAGCTTGG + Intronic
1202745613 3_GL000221v1_random:98955-98977 ATATATATATATATATAGGCTGG + Intergenic
968793017 4:2681626-2681648 GTCTATGTATTTATTTACGTAGG + Intronic
969061581 4:4439566-4439588 GTGTGTGTATATATATGGGTAGG - Intronic
969130102 4:4984858-4984880 ATGGATATATATATTTTTGTAGG + Intergenic
969165189 4:5303004-5303026 GTGTATATATATGTATATGTGGG + Intronic
969368815 4:6717567-6717589 GTGTGTGTATATATATATGTGGG + Exonic
969904362 4:10379667-10379689 GTGTATATATAAATATATGGGGG - Intergenic
970130746 4:12867720-12867742 GTATATATATATATACACGTAGG - Intergenic
970636024 4:18010452-18010474 GTATATATATATATTTGAGATGG + Intronic
970654006 4:18211301-18211323 GGGTGTATATATATTCAGGATGG + Intergenic
970765672 4:19545876-19545898 GTGTATATATATGTATATGTAGG + Intergenic
970765966 4:19549365-19549387 GTGTATATATATGTATATGTAGG + Intergenic
970873118 4:20839494-20839516 TTATATATATATATATAGATAGG + Intronic
970899916 4:21146959-21146981 ATGTATATGTATATATATGTGGG + Intronic
971381304 4:26100791-26100813 ATGTAAATATAATTTTAGGTAGG - Intergenic
971547054 4:27899262-27899284 GTGTATATATATATTTATTTGGG - Intergenic
971572446 4:28230579-28230601 GTGTATATGTATTTGTATGTAGG + Intergenic
971587055 4:28417208-28417230 GTGTGTATATATATATATGAAGG + Intergenic
971605095 4:28649072-28649094 GGGTGCATATATATTTAGGATGG + Intergenic
971624062 4:28896027-28896049 GGGTACATATATATTTAGGATGG - Intergenic
971758307 4:30731359-30731381 GTGTATATATATATATATGCTGG + Exonic
971759858 4:30751617-30751639 GTATATATATATATTTTGCATGG + Intronic
971822382 4:31574815-31574837 GGGTATCTCTATATTTAGGGTGG - Intergenic
971961135 4:33488346-33488368 CTGTATATATATATTTGAGATGG - Intergenic
972051429 4:34739573-34739595 ATGTATATATATATATATGTTGG - Intergenic
972083931 4:35189575-35189597 CTCTATAAATATATTTATGTAGG - Intergenic
972087220 4:35233910-35233932 GTGTATATATATATGCTTGTTGG - Intergenic
972180576 4:36459762-36459784 GTTTATATATATATTTTTGTTGG + Intergenic
972280559 4:37598019-37598041 GTGTATATATATATGTAGGCTGG - Intronic
972516946 4:39817875-39817897 ATATATATATATATATAGCTGGG - Intergenic
972700209 4:41486941-41486963 GTGTATATATATATATCAGCTGG - Intronic
973065120 4:45780545-45780567 ATGTATATATATATTTCACTGGG - Intergenic
973092322 4:46153237-46153259 GGATATATTTAAATTTAGGTGGG - Intergenic
973556579 4:52089974-52089996 GGGTGCATATATATTTAGGATGG + Intronic
974097450 4:57380049-57380071 GTGTGTATATATATATATGATGG + Intergenic
974182243 4:58399457-58399479 GGGTGTATATATATTTAGGCTGG + Intergenic
974308673 4:60175191-60175213 ATATATATATATATATAGTTGGG - Intergenic
974501407 4:62708685-62708707 GTGTATGTGTATATTTCTGTTGG - Intergenic
974663706 4:64929977-64929999 GTATATATATATATGAAGGGGGG + Intergenic
974874695 4:67688730-67688752 TTGTACATATATATTTAACTAGG - Intronic
974984006 4:68996170-68996192 GTATATATATATATATATCTTGG + Intergenic
975361016 4:73472260-73472282 GTGCATATATATATTTAGGATGG + Intergenic
975427977 4:74253238-74253260 ATGAACATATATATTTTGGTGGG - Intronic
975430244 4:74281361-74281383 GTGTACATATCTGTTTTGGTAGG - Intronic
975522525 4:75315874-75315896 GGGTGGATATATATTTAGGATGG - Intergenic
975708797 4:77138328-77138350 GTGTAAATATATATATATTTAGG + Intergenic
975708798 4:77138332-77138354 AAATATATATATATTTAGGCCGG + Intergenic
975812928 4:78188322-78188344 CTATCTATCTATATTTAGGTTGG + Intronic
975858229 4:78647595-78647617 ATATATATATATTTTTAGATGGG - Intergenic
975901295 4:79156329-79156351 GTATATATATATATTCATATAGG + Intergenic
975902312 4:79167250-79167272 CTATATATATATATATATGTGGG - Intergenic
975929305 4:79499438-79499460 GTGAATGTATGTATGTAGGTAGG + Intergenic
975967248 4:79988261-79988283 ATATATATATATATATATGTAGG + Intronic
975987020 4:80209955-80209977 CTATATATATATATTTTAGTTGG + Intergenic
976056612 4:81076798-81076820 ATGTATGTATATATGTGGGTGGG - Intergenic
976314463 4:83644263-83644285 ATATATATATATATTTTAGTCGG + Intergenic
976789072 4:88857120-88857142 GGGAATATATATTTTTAGGAGGG + Intronic
976819126 4:89185154-89185176 GTATATATATTTATTTTGCTAGG - Intergenic
977015631 4:91690056-91690078 GTGTGCATATATATTTGGGATGG + Intergenic
977027909 4:91843731-91843753 GTATATATATATATATATTTGGG + Intergenic
977061696 4:92266402-92266424 GTGTGTGTATTTATTTATGTGGG - Intergenic
977322090 4:95530013-95530035 TTGCATATATATTTTTAGATGGG + Intronic
977540173 4:98308269-98308291 GTGTGTATATATATGTGTGTGGG - Intronic
977771501 4:100866495-100866517 GGGTGCATATATATTTAGGATGG + Intronic
978068725 4:104439455-104439477 GGGTGCATATATATTTAGGATGG - Intergenic
978302498 4:107287137-107287159 GTATATACATATATATAAGTAGG + Intergenic
978418032 4:108499377-108499399 ATATATATATATATATAGCTGGG - Intergenic
978761728 4:112360457-112360479 GTGTGTATGGAAATTTAGGTTGG + Intronic
978856388 4:113399282-113399304 GTGTATACATGTGTATAGGTAGG - Intergenic
979015619 4:115429655-115429677 ATATATATATATATTTTGGGGGG + Intergenic
979065283 4:116123668-116123690 ATTAATATATATATTTAGCTTGG - Intergenic
979325972 4:119379924-119379946 ATGTATATATATATATATGATGG - Intergenic
979947134 4:126846099-126846121 GTGTATACTTGTATTTAGGAAGG + Intergenic
980312970 4:131158677-131158699 GTGTATATATATAGGTAGATGGG - Intergenic
980373311 4:131908514-131908536 ATATATATATATATATAGATGGG - Intergenic
980445577 4:132902648-132902670 GTGTATATATACATATACATTGG - Intergenic
980616390 4:135231127-135231149 ATATATATATATATATAGATGGG - Intergenic
980683320 4:136192327-136192349 GTATATATATATATATATGTAGG - Intergenic
980828914 4:138105990-138106012 ATATATATAAATATTTAGGTTGG - Intergenic
980858345 4:138467983-138468005 GTGTGTATATATATTTTTATTGG + Intergenic
981168651 4:141594434-141594456 TTTTATATATATATTTAAGAAGG - Intergenic
981180846 4:141742263-141742285 ATATATATTTATAGTTAGGTGGG + Intergenic
981580195 4:146242827-146242849 ATATATATATATATTTCGGGAGG + Intergenic
981626389 4:146760752-146760774 GTGTATATATATATATATGATGG + Intronic
981909843 4:149966431-149966453 GTCTGTATTGATATTTAGGTGGG + Intergenic
981950583 4:150401843-150401865 GTGTGTATATATAATTATGTGGG + Intronic
982145776 4:152389382-152389404 GTGTAAACATATATATATGTGGG - Intronic
982186283 4:152804501-152804523 ATATATATATATATATAGTTGGG + Intronic
982748292 4:159128899-159128921 GTGTATATATATACATATGGGGG + Intronic
983404312 4:167307431-167307453 ATATATATATATATATAGTTTGG + Intergenic
983411327 4:167402345-167402367 GAATACATATATATTTATGTAGG - Intergenic
983447370 4:167870590-167870612 GTGTGTATATATATATATATGGG + Intergenic
983617729 4:169726253-169726275 ATGTATGTATATATATATGTAGG - Intergenic
983724163 4:170898740-170898762 CATTATATATATATATAGGTAGG + Intergenic
983775762 4:171605027-171605049 ATGTATATATATATATAAGTTGG - Intergenic
983826751 4:172271936-172271958 ATATATATATATATTTATGATGG - Intronic
984158179 4:176219602-176219624 ATATATATATATATATAGGCTGG + Intronic
984207597 4:176804494-176804516 ATATATATATATGTTTAGGCTGG - Intergenic
984302360 4:177938135-177938157 GTATATATATATATATAGTGTGG + Intronic
984459069 4:180009745-180009767 GTATATATATATATATATGTTGG - Intergenic
984501219 4:180561652-180561674 GTGTAAATATATAATTGGGTAGG - Intergenic
984540498 4:181031750-181031772 GTGTGTGTATATACGTAGGTGGG - Intergenic
984611134 4:181839388-181839410 ATGTATATATATATGTATATAGG - Intergenic
984655510 4:182313490-182313512 GTATATATATATATTTAAAATGG - Intronic
984876560 4:184373374-184373396 GTATATATATATATATATGAAGG + Intergenic
985044530 4:185927207-185927229 GTGTATATATAATTTTTGTTTGG + Intronic
985093380 4:186387241-186387263 GTGTATATATATATATATGATGG + Intergenic
985262901 4:188131516-188131538 ATATATATATATATTTAGCTAGG - Intergenic
985392863 4:189509639-189509661 CTGAATATAGATATTTTGGTTGG + Intergenic
986036529 5:3945562-3945584 GTGTATATATATATATATAGTGG + Intergenic
986167061 5:5282864-5282886 GTTTATAGATTTATTTATGTAGG + Intronic
986313198 5:6570009-6570031 GTGTATATATATATATATAAAGG + Intergenic
986372708 5:7096611-7096633 GTGTATGTATATGTGTAAGTGGG - Intergenic
986440480 5:7777050-7777072 GTATATATATATATATAGAAGGG - Intronic
986553811 5:8989740-8989762 GTGTATTTATATATTTATCCAGG + Intergenic
986995060 5:13597503-13597525 ATGTATATATATATATAGCAAGG - Intergenic
987006275 5:13713164-13713186 CCGTATATATATATATATGTCGG - Intronic
987024262 5:13908279-13908301 ATGTAGATGTTTATTTAGGTAGG - Intronic
987197462 5:15541349-15541371 GTGTATATATACATATAGTTTGG - Intronic
987551411 5:19386810-19386832 ATGAATATATATATGTGGGTGGG - Intergenic
987668672 5:20980463-20980485 GTGTATATATATATATAAAGGGG - Intergenic
987705357 5:21456960-21456982 GTGTGTATATATATATATATGGG + Intergenic
987781024 5:22435387-22435409 GTGTGTATATATATATATGGGGG - Intronic
987838239 5:23188579-23188601 GGGTGCATATATATTTAGGATGG - Intergenic
987901271 5:24014937-24014959 ATATATGTATATATTTAAGTAGG + Intronic
987966371 5:24881538-24881560 GTGTATGTATATATGTATTTTGG + Intergenic
988387415 5:30583193-30583215 ATATATATATATATAAAGGTAGG - Intergenic
988770906 5:34432440-34432462 GGGTGCATATATATTTAGGATGG + Intergenic
988894836 5:35661380-35661402 ATATATATATATATTTATCTTGG - Intronic
989657188 5:43757770-43757792 GGGTGCATATATATTTAGGATGG + Intergenic
989723079 5:44552882-44552904 GTGTGTATATATATATATGTAGG - Intergenic
989807449 5:45627015-45627037 GTGTACATATATATATAACTGGG + Intronic
990037212 5:51336039-51336061 ATGTGTCTTTATATTTAGGTAGG + Intergenic
990452464 5:55948598-55948620 GTGTATATATATATTGATATGGG + Intronic
990567728 5:57046455-57046477 GTGTATCTCTCTATTTAGTTAGG + Intergenic
990909449 5:60839034-60839056 ATATATATATATATTTATGATGG + Intronic
990934748 5:61136029-61136051 ATATATATATATATCTAGGGTGG + Intronic
991299692 5:65118176-65118198 CTTTATATATATAGTTAGATCGG + Intergenic
991379500 5:66005080-66005102 GTCTATATATATATATAGACAGG + Intronic
991643906 5:68781481-68781503 ATGTGTATATATATATAGATAGG + Intergenic
991643907 5:68781485-68781507 GTATATATATATAGATAGGTTGG + Intergenic
991720525 5:69491669-69491691 GTGTATATTTTTATGTATGTTGG - Intergenic
991893981 5:71372291-71372313 GTAGATATATATATATATGTTGG + Intergenic
992058561 5:73018855-73018877 GTGTACATAATTATTTAGGAAGG - Intronic
992462623 5:76975956-76975978 GTGTATATATATATATATGTTGG + Intronic
992481904 5:77159582-77159604 GTTCATATATGTATTTGGGTTGG + Intergenic
992567668 5:78015292-78015314 GTGTATATATATATATGTTTAGG + Intronic
992634299 5:78712184-78712206 GGGTGCATATATATTTAGGATGG - Intronic
992679381 5:79138861-79138883 ATATATATATATATATATGTAGG + Intronic
993296474 5:86147589-86147611 GTGTATATATATCTTTGTATAGG + Intergenic
993348181 5:86812062-86812084 GTGTACATATGTATATAGGTAGG - Intergenic
993629097 5:90262324-90262346 GTGTGTATATATATATATGATGG - Intergenic
993799544 5:92315461-92315483 ATGTATACATAAATCTAGGTAGG - Intergenic
994006866 5:94847692-94847714 ATATATATATATATGTATGTTGG + Intronic
994142613 5:96359027-96359049 GAGTGCATATATATTTAGGATGG + Intergenic
994247250 5:97492383-97492405 ATATATATATATATTTAGCTGGG - Intergenic
994472327 5:100223515-100223537 ATGATTATATATATTTATGTAGG - Intergenic
994540308 5:101086810-101086832 GTGTATATATATGTGTATATGGG - Intergenic
994542108 5:101112145-101112167 GGGTGCATATATATTTAGGATGG + Intergenic
994548051 5:101193964-101193986 GTGTGTATATGTATGTAGGTAGG - Intergenic
994884788 5:105546354-105546376 GCCTATATATAAATTTAGGAAGG + Intergenic
995093673 5:108211001-108211023 GGGTGCATATATATTTAGGATGG + Intronic
995698642 5:114907802-114907824 TATTATATATATATATAGGTAGG - Intergenic
995832995 5:116374230-116374252 GTGTATATATATATATATATAGG - Intronic
995845113 5:116485093-116485115 GGGTATGTATATTTTTAGGTGGG + Intronic
996150935 5:120033983-120034005 ATATATATATATATATATGTAGG + Intergenic
996219032 5:120906125-120906147 GTATATATATATATATATTTAGG + Intergenic
996245658 5:121261329-121261351 GTGCATATATATATTTAGCATGG + Intergenic
996357821 5:122616398-122616420 ATATATATATATATATAGATTGG - Intergenic
996797163 5:127360862-127360884 GTGTATATATATATATATGTTGG + Intronic
996858072 5:128032026-128032048 ATATATATATATATTTTGTTTGG - Intergenic
996866314 5:128126937-128126959 ATATATATATATATATATGTAGG - Intronic
996918822 5:128743072-128743094 GTTTATATATATTGTAAGGTAGG + Intronic
997037296 5:130208026-130208048 GTATATATATATAGATAGGTGGG + Intergenic
997207457 5:132058195-132058217 GTGTATATATATAATTTTTTTGG + Intergenic
997243783 5:132328820-132328842 GTGTATATATATATATATAAAGG - Intronic
997637400 5:135423898-135423920 ATGTATATAAATATATATGTGGG - Intergenic
997652279 5:135531302-135531324 GTGTATACAAATATATATGTTGG + Intergenic
998452252 5:142244157-142244179 GTTTATATATATATATATATTGG - Intergenic
998704311 5:144741076-144741098 GTATATATATATATGGAGGGAGG - Intergenic
998713859 5:144858201-144858223 GTGAATATATATATATAAGATGG + Intergenic
998728778 5:145049793-145049815 GTGTGTATATATATGTGTGTGGG + Intergenic
998754026 5:145356459-145356481 GGGTATATATCTATTTTGGATGG + Intergenic
998807122 5:145929194-145929216 ATATATATATATATATAGGGGGG - Intergenic
998951511 5:147397173-147397195 GTGTGTATATATATATATATAGG - Intronic
999231102 5:150062240-150062262 ATATATATATATATTTGGATGGG - Intronic
999284976 5:150389086-150389108 ATGTACATATGTATGTAGGTAGG - Intronic
999461423 5:151760090-151760112 ATGTATGTATATATTTATGCAGG - Intronic
1000208540 5:159087249-159087271 GTGTATATATATATATATTAGGG - Intronic
1000239012 5:159391801-159391823 CTCTCTATATATATTTAGTTTGG + Intergenic
1000292830 5:159886856-159886878 ATGTATATATATATTTACAGAGG - Intergenic
1000385805 5:160673682-160673704 GTTTATTTATATATTTAGGGTGG + Intronic
1000402372 5:160844189-160844211 GTATATATATATATTTCTGTTGG - Intronic
1000471362 5:161646065-161646087 ATATATATATATATATAGCTGGG + Intronic
1000568955 5:162886507-162886529 GTGTATATATGTATGTATATAGG + Intergenic
1000641521 5:163708497-163708519 GTATATATATATATATATTTAGG - Intergenic
1000794966 5:165653733-165653755 TTGTAGATATATATTTATGTGGG + Intergenic
1001516775 5:172361088-172361110 GTATATATATGTATTTTTGTGGG - Intronic
1001665216 5:173427359-173427381 GTGTTTATATATATGTGGGGGGG - Intergenic
1001733965 5:173983453-173983475 CTGTATATATATATTTCTGCTGG - Intronic
1001798467 5:174522577-174522599 GTGTATATACACATCTATGTAGG + Intergenic
1002654253 5:180731133-180731155 ATATACATATATATTTAGGCCGG + Intergenic
1002848938 6:974167-974189 GTGTATATATATATATACCATGG + Intergenic
1002848943 6:974243-974265 GTGTATATATATATATATATGGG + Intergenic
1002918718 6:1550103-1550125 GTATATATATATTTTTAGACAGG - Intergenic
1002963475 6:1939566-1939588 GTGTGTATATATATGTATATAGG - Intronic
1003028944 6:2583867-2583889 GTGTATATATATATATATGATGG - Intergenic
1003103020 6:3191929-3191951 GTATATATATATATTTTTTTTGG + Intergenic
1003105729 6:3214244-3214266 CTGGATATAGATTTTTAGGTTGG - Intergenic
1003416645 6:5915547-5915569 GGGTGCATATATATTTAGGATGG + Intergenic
1003526184 6:6899649-6899671 ATATATATATATATATGGGTCGG + Intergenic
1003876222 6:10439840-10439862 GTGTGTATATACATTTAGAGAGG - Intergenic
1004072403 6:12312446-12312468 GTGTATATATACATTTGAGATGG - Intergenic
1005008921 6:21317247-21317269 ATGTATATATATTTGTAAGTAGG - Intergenic
1005216881 6:23539838-23539860 ATATATATATATATATAGATGGG - Intergenic
1005320908 6:24652722-24652744 GTGTGTATATATATATATATAGG - Intronic
1005893591 6:30159961-30159983 GTGTTTACATATATTCAGGCTGG - Intronic
1006226475 6:32541802-32541824 GTTTACATATATTTTTAGTTTGG + Intergenic
1007040623 6:38718553-38718575 ATGTATTTATATATTTATTTTGG + Intronic
1007083422 6:39125442-39125464 GTGTGTATATATATATATTTGGG - Intergenic
1007746276 6:44045162-44045184 GTGTGTATATGAATGTAGGTAGG - Intergenic
1008314143 6:50018540-50018562 GTGGATTTATATATTTACGTGGG + Intronic
1008732131 6:54495206-54495228 GTGGATATAACTTTTTAGGTTGG - Intergenic
1008971280 6:57371674-57371696 ATATATTTTTATATTTAGGTTGG + Intronic
1008973579 6:57398836-57398858 GAGTGCATATATATTTAGGATGG + Intronic
1009000090 6:57702849-57702871 GGGTGCATATATATTTAGGATGG - Intergenic
1009162476 6:60300388-60300410 GAGTGCATATATATTTAGGATGG + Intergenic
1009191323 6:60633479-60633501 GGGTGCATATATATTTAGGATGG + Intergenic
1009744063 6:67789859-67789881 GAGTATATGTTTATTTAGGCAGG - Intergenic
1009760918 6:68004475-68004497 GTATATATATATATATAGCCAGG + Intergenic
1009819623 6:68783283-68783305 ATATATATATATATTTAGGGAGG - Intronic
1009883090 6:69593648-69593670 TTGTACATATATATGTATGTGGG - Intergenic
1009964327 6:70562759-70562781 ATGTATATATATATTTGAGTTGG - Intergenic
1009988414 6:70810476-70810498 GTGGATATATATATTTCCATGGG - Intronic
1010164585 6:72900476-72900498 GAGTATATATATATATATGATGG - Intronic
1010344628 6:74797472-74797494 ATATATATATATATATATGTTGG - Intergenic
1010451320 6:76006456-76006478 GTGTATATACATATGTATATAGG + Intronic
1010864554 6:80958921-80958943 ATATATATATATATATATGTAGG + Intergenic
1010923185 6:81710135-81710157 GTGTGTATATATATGTGTGTGGG + Intronic
1011893730 6:92198437-92198459 ATATATATATATATTTAGCCAGG - Intergenic
1011909565 6:92419751-92419773 GTGTATATATATATCTTGATTGG - Intergenic
1012015639 6:93846664-93846686 ATATATATATATATATATGTAGG + Intergenic
1012110094 6:95219314-95219336 ATGTATATATATATTTTTGTTGG - Intergenic
1012272154 6:97226699-97226721 GTGTGTATATATATGTATGTAGG + Intronic
1012272155 6:97226703-97226725 GTATATATATGTATGTAGGTAGG + Intronic
1012381585 6:98626177-98626199 GTTTGTGTATATATTTATGTTGG + Intergenic
1012726144 6:102813276-102813298 ATATATATATATATGTAGTTTGG + Intergenic
1012820389 6:104079593-104079615 GTATATATATATATATATATGGG - Intergenic
1012876035 6:104727105-104727127 GTGTGTATATATATGTATATGGG + Intergenic
1012923288 6:105242275-105242297 GTGTATATATTTAGTTACTTTGG + Intergenic
1012994496 6:105959998-105960020 ATATATATATATAATTAGCTGGG - Intergenic
1013199293 6:107877117-107877139 GTGTATATATATATTTTAGAAGG + Intronic
1013210735 6:107984450-107984472 GTGTATATATATATTAGGCTAGG + Intergenic
1013721163 6:113029889-113029911 GTGTGTATATATATATATGACGG - Intergenic
1013772819 6:113646458-113646480 ATATATATATATATATATGTAGG - Intergenic
1013791389 6:113840745-113840767 GAGTACATATATATTCGGGTTGG - Intergenic
1013839520 6:114373958-114373980 GTGTATATATATAAATACATTGG + Intergenic
1013853762 6:114546409-114546431 ATATATATATATATTTAGTTAGG - Intergenic
1013995145 6:116299598-116299620 GTGTGTATATGTATGTATGTAGG + Intronic
1013995146 6:116299602-116299624 GTATATGTATGTATGTAGGTAGG + Intronic
1014066427 6:117132353-117132375 GTGTATATATATATATAAAGGGG + Intergenic
1014176786 6:118340233-118340255 GGGTGCATATATATTTAGGATGG + Intergenic
1014338343 6:120168829-120168851 ATATATATATATATGTATGTAGG - Intergenic
1014508581 6:122291386-122291408 GTGTGTATATATATATATGCAGG + Intergenic
1014649772 6:124021693-124021715 ATGTATAGATATATATAGATGGG - Intronic
1014733555 6:125064838-125064860 GTGTGTATATATATATAGTTAGG + Intronic
1014788277 6:125642928-125642950 ATATATATATATATATAGTTTGG + Intergenic
1014788279 6:125642932-125642954 ATATATATATATAGTTTGGTGGG + Intergenic
1015109165 6:129571424-129571446 GTGTACATATATATTTAGGATGG - Intergenic
1015133254 6:129837872-129837894 GTGTGCATATATATTTAGGATGG - Intronic
1015184573 6:130400043-130400065 GTGTATGTATATATATATGATGG - Intronic
1015467354 6:133561661-133561683 GTGTATATATATATATATATAGG + Intergenic
1015901099 6:138068416-138068438 ATGTATATATATATCTATCTTGG + Intergenic
1015925452 6:138305448-138305470 GTATATATATACATATAGCTGGG + Intronic
1016196984 6:141356070-141356092 GTGTGTATATATATATATGATGG - Intergenic
1016651991 6:146472556-146472578 GTGTATATATATATGATTGTGGG - Intergenic
1016700997 6:147054145-147054167 TTGAATATATAAATTTTGGTGGG - Intergenic
1017148542 6:151256943-151256965 GTTTATATATATATATAGGCCGG - Intronic
1017189273 6:151634742-151634764 GCCTATATATATATATATGTGGG + Intergenic
1017447392 6:154519294-154519316 ATATATATATATATATATGTTGG + Intergenic
1017505676 6:155066673-155066695 GTGTATATATATAATTTTTTTGG + Intronic
1017613636 6:156219212-156219234 GTGTATATATATTTATATATTGG - Intergenic
1017710286 6:157161441-157161463 ATATATATATATATTTTGGCGGG + Intronic
1018010258 6:159663353-159663375 GTGTATATATATATATATGATGG - Intergenic
1018532208 6:164778523-164778545 TTATATATATATATTTCTGTTGG - Intergenic
1018850210 6:167582289-167582311 GTGTGTATATATATATGTGTGGG + Intergenic
1019065573 6:169293642-169293664 GTGTATATATATATTTGAGATGG + Intergenic
1019938946 7:4274136-4274158 GTGTATGTATATGTGTATGTGGG + Intergenic
1020273835 7:6613326-6613348 ATATATATATATATATAGTTTGG - Intergenic
1020594854 7:10193520-10193542 GTGTATATATATTTTTGAATGGG - Intergenic
1020712477 7:11625153-11625175 ATGTATATTCATATTTATGTAGG + Intronic
1020798842 7:12708773-12708795 GTATATATAAATATATAGGTAGG - Intergenic
1020937746 7:14488665-14488687 GTATATATATAAAATTAGCTCGG + Intronic
1020973180 7:14972894-14972916 GTGTATACATACATATAGGTGGG + Intronic
1020996786 7:15275725-15275747 GGGTGCATATATATTTAGGATGG + Intronic
1021259577 7:18437527-18437549 GTGTATATATATATATAATCTGG + Intronic
1021273292 7:18618744-18618766 ATATATATATATATATATGTAGG + Intronic
1021290559 7:18838566-18838588 GAGTATATACATATATAGATGGG - Intronic
1021330113 7:19326539-19326561 GTATATATATATATTAAGTGTGG - Intergenic
1021575821 7:22104799-22104821 ATATATATATATATTTAAGCTGG - Intergenic
1021618096 7:22523254-22523276 TAGTATATATATATTAAGGCTGG - Intronic
1021695820 7:23275383-23275405 ATATATATATATATGTAGTTAGG - Intergenic
1021824517 7:24535300-24535322 GGGTGCATATATATTTAGGATGG + Intergenic
1022128596 7:27381172-27381194 ATATATATATATATTTGGATTGG - Intergenic
1022322660 7:29301866-29301888 GTGGAAATATATGTTTAAGTCGG - Intronic
1022372182 7:29782441-29782463 GGATATAAATATATTTAGGTAGG + Intergenic
1022380610 7:29856035-29856057 ATGTATGTATATATGTAGATAGG + Intronic
1022564762 7:31386879-31386901 GTGTATATACATATACACGTGGG + Intergenic
1022826944 7:34024417-34024439 ATATATATATATATATATGTTGG + Intronic
1022863350 7:34390981-34391003 ATATATATATATATATAGCTTGG - Intergenic
1022978937 7:35584905-35584927 GTGTGTGTGTATAGTTAGGTAGG + Intergenic
1023151991 7:37210501-37210523 GTGTGTATATATATATATTTGGG + Intronic
1023253868 7:38293320-38293342 ATATATGTATATATTTCGGTGGG + Intergenic
1024052259 7:45633463-45633485 GATTATACATGTATTTAGGTTGG + Intronic
1024140555 7:46459128-46459150 GTCTATTTATATATCTAGTTAGG + Intergenic
1024173871 7:46818507-46818529 ATATATATATATATTTAGGAAGG - Intergenic
1024401616 7:48929971-48929993 ATGTATGTATGTATGTAGGTAGG + Intergenic
1024422137 7:49181055-49181077 GTACATATATATTTTTAAGTAGG - Intergenic
1024859502 7:53821912-53821934 GTATATATATATATTTGAGATGG - Intergenic
1025297266 7:57785721-57785743 ATGTATATACAAATATAGGTTGG + Intergenic
1025298034 7:57792355-57792377 ATGTATATACAAATATAGGTTGG + Intergenic
1025728771 7:64091632-64091654 GTGTGTATATATATATATATGGG + Intronic
1025791815 7:64695099-64695121 ATGTATATATATATTTATTTGGG - Intronic
1025960304 7:66214817-66214839 ATTTATATATATATTTTTGTTGG - Intronic
1026136597 7:67667999-67668021 GTGTATATATACATATGTGTGGG - Intergenic
1026294968 7:69043399-69043421 GTGTATATATATATATTTATAGG - Intergenic
1026413078 7:70146953-70146975 ATGTGTACATATATGTAGGTAGG + Intronic
1026676107 7:72429821-72429843 GTCTATATATATATTTGAGATGG + Intronic
1027252083 7:76405262-76405284 ATATATATATATAATTAGCTGGG - Intronic
1027301902 7:76847211-76847233 GTGTATAAATATTTTCAGGCCGG - Intergenic
1027812871 7:82927776-82927798 TTGAAAATATATATTTATGTAGG - Intronic
1027862603 7:83604576-83604598 GTGTGTATATATATATATGTTGG - Intronic
1027964745 7:84991135-84991157 GGGTGCATATATATTTAGGATGG + Intergenic
1028094424 7:86742641-86742663 GAGTTTAGATATATTTAGGTAGG + Intronic
1028302631 7:89220177-89220199 GTGTATATATATATATCCTTGGG + Intronic
1028935353 7:96457806-96457828 GTGTATACATATATATATTTGGG - Intergenic
1028946223 7:96583663-96583685 GGGTGCATATATATTTAGGATGG + Intronic
1029607450 7:101607755-101607777 GTGTATATATATATATATATGGG - Intergenic
1029862211 7:103584515-103584537 GGGTACATATATGTTTAGGATGG - Intronic
1030122542 7:106124135-106124157 GGGTGTATATATATTTCCGTAGG - Intergenic
1030278549 7:107745034-107745056 GTGTGTATGTTTATTTATGTAGG + Intronic
1030454178 7:109751893-109751915 GTGTGTATATATATTTGAGATGG - Intergenic
1030519525 7:110580713-110580735 ATGTATATATATATATAGGAAGG + Intergenic
1030676384 7:112390175-112390197 GTGTATATGTATATATGGGGTGG - Intergenic
1030911503 7:115256270-115256292 ATATATATATATATTTAGCCGGG - Intergenic
1031535165 7:122924920-122924942 GTATATATATATATATATATGGG - Intergenic
1031603314 7:123739914-123739936 GTATATATATATATATATGCTGG + Intronic
1031632173 7:124056807-124056829 GTGTTTAGATATGTTTGGGTAGG - Intergenic
1031677473 7:124628637-124628659 GTATATATATATATATATATGGG - Intergenic
1031692725 7:124810386-124810408 GGGTATATATTAATTTAAGTAGG + Intergenic
1031714224 7:125087351-125087373 GTGTCTATATATATTCTTGTAGG - Intergenic
1031788737 7:126071438-126071460 GGGTATATATTTATATATGTGGG - Intergenic
1032030094 7:128476229-128476251 GTGTGTATATATATTTTGGTTGG - Intergenic
1032144339 7:129365626-129365648 GAGTATATATATATATATATGGG + Intronic
1033065805 7:138152855-138152877 ATGTATATATATTTCTTGGTTGG - Intergenic
1033081049 7:138297647-138297669 GTGCATATGTATATTTGGATTGG - Intergenic
1033113965 7:138608955-138608977 GTGTATATATATGTGTGGGTGGG - Intronic
1033187368 7:139240421-139240443 ATATATATATATATTTAGGCTGG - Intronic
1033277943 7:139986718-139986740 GTATATATATATATATATGATGG - Intronic
1033727665 7:144136539-144136561 ATGTATATCTTTATTTAGGCTGG - Intergenic
1033754417 7:144386206-144386228 ATGAATATATATATTGAGATAGG + Intergenic
1033859280 7:145605382-145605404 ATATATATATATATTTAAGGTGG - Intergenic
1034058316 7:148059765-148059787 TTATATATATATATTTAGTAAGG + Intronic
1034297074 7:149983447-149983469 GTGTATATATATATATATGTAGG + Intergenic
1034808952 7:154113390-154113412 ATATATATATATATATATGTAGG - Intronic
1035007119 7:155673455-155673477 GTGTATGTATATATATATGTGGG - Intronic
1035180579 7:157086496-157086518 GTGTATATATATGTAGGGGTGGG - Intergenic
1035839743 8:2797807-2797829 ATATATATATATATATATGTAGG + Intergenic
1035854175 8:2956035-2956057 ATGTATAAATATATATAGGATGG - Intronic
1035906763 8:3520019-3520041 GTATATATATATATATATATAGG - Intronic
1036113620 8:5933727-5933749 GTGTTTTTATAAATTTAGGGTGG + Intergenic
1036146812 8:6261597-6261619 ATATATATATATAATTAGCTGGG + Intergenic
1036395350 8:8365789-8365811 GTGTGTATATATATATATATAGG - Intronic
1036987478 8:13551866-13551888 GTATATATATATATATAGACAGG + Intergenic
1037072515 8:14669195-14669217 ATATATATATATATATAGCTGGG + Intronic
1037082661 8:14805530-14805552 GGGTGCATATATATTTAGGATGG - Intronic
1037357491 8:18037547-18037569 GTGTATATATATATTTTGGCTGG + Intergenic
1037452239 8:19026874-19026896 ATATATATATATTTTTGGGTGGG - Intronic
1037481499 8:19310122-19310144 GTGTATATATATGTTTTAGATGG - Intergenic
1037544481 8:19905543-19905565 GTGGATAGATATAGATAGGTAGG + Intronic
1037598283 8:20372890-20372912 ATGTATATATAGATATAGATAGG + Intergenic
1037699444 8:21261394-21261416 GTGTATATATATACATACATTGG - Intergenic
1038020234 8:23546618-23546640 GTGTATATATATATATATTTGGG + Intronic
1038025878 8:23590359-23590381 ATATATATATATATATATGTTGG + Intergenic
1038052953 8:23830599-23830621 GTGTATATATATATATATGATGG - Intergenic
1038323401 8:26550549-26550571 CTGTATTTTTATATTTAGGGTGG - Intronic
1038463570 8:27738572-27738594 GTATATGTATGTATGTAGGTCGG + Intronic
1038647186 8:29371709-29371731 ATATATATATATATATATGTAGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038821963 8:30960524-30960546 ATATATATATATAATTAGCTAGG + Intergenic
1039215948 8:35271757-35271779 ATGTATACATATATTTACATAGG + Intronic
1039932275 8:42004102-42004124 GTGTATAAGGATATTTAGTTAGG + Intronic
1040396210 8:47002788-47002810 GTAGATATATAGATATAGGTAGG + Intergenic
1040540896 8:48354175-48354197 GGGTGCATATATATTTAGGATGG - Intergenic
1040721278 8:50327541-50327563 GTGTATCTTCATATTTAAGTGGG + Intronic
1040822395 8:51577416-51577438 GTGTATATATGTATATAGAGAGG + Intronic
1041251871 8:55942260-55942282 GTGTGTATATATATATAGTGGGG - Intronic
1041470804 8:58206681-58206703 ATGTATATATTTATTTATTTTGG + Intergenic
1041479425 8:58302085-58302107 GTGAATATATATTTTTATTTTGG - Intergenic
1041861933 8:62524217-62524239 ATATATATATATATTTTGGTGGG - Intronic
1042201552 8:66283594-66283616 GTGTGTATATATATATATGATGG + Intergenic
1042224789 8:66506898-66506920 GTGTCTATATATAGGTGGGTGGG + Intronic
1042231346 8:66558215-66558237 GTGAATATGGATATTTTGGTGGG + Intergenic
1042236185 8:66615305-66615327 ATGTATATATATATCTCGTTTGG - Intergenic
1042308491 8:67356629-67356651 GGGTGCATATATATTTAGGATGG + Intergenic
1042395295 8:68285266-68285288 AAATATATATATATTTAGATAGG - Intergenic
1042714507 8:71757960-71757982 GTGTATATATATATAGAGAAAGG - Intergenic
1042735468 8:71983087-71983109 GTGTATATATATATATAGCTAGG + Intronic
1042880804 8:73486608-73486630 GTGTATATATATATATATAATGG - Intronic
1043228190 8:77761589-77761611 TTATATATATATATTTACCTTGG - Intergenic
1043244888 8:77985389-77985411 GTGTATATATATATGTGTGTGGG - Intergenic
1043396740 8:79844794-79844816 GGGTACATATATATCTAGGATGG - Intergenic
1043618123 8:82153202-82153224 GTGTACATATATATTCATTTTGG + Intergenic
1043674955 8:82939280-82939302 GGGTACATATATATTCAGGATGG - Intergenic
1043677237 8:82972874-82972896 GGGTATATATATATATATATGGG + Intergenic
1043748670 8:83908167-83908189 GGGTGCATATATATTTAGGATGG + Intergenic
1043763411 8:84098402-84098424 ATATATATATATATATATGTTGG + Intergenic
1043884836 8:85587243-85587265 GTGTAGATATATTTTCAGGCCGG - Intergenic
1043889555 8:85641603-85641625 GTGTGTATATATGTTTGTGTGGG + Intergenic
1044446942 8:92289308-92289330 GTGGAAATATATATTTATGTGGG + Intergenic
1044497027 8:92898857-92898879 ATATATATATATATATAGATGGG + Intronic
1044714673 8:95089460-95089482 GTGTATATATATATATAAAAGGG + Intronic
1045082753 8:98646533-98646555 GTGTTTGTATATATTAGGGTTGG - Intronic
1045097736 8:98815979-98816001 ATATATATATATATATAGATGGG - Intronic
1045139473 8:99264490-99264512 CTGTATATAGATTTTTAGGGTGG + Intronic
1045166826 8:99615940-99615962 ATAAATATATATATGTAGGTAGG + Intronic
1045327012 8:101124655-101124677 GTGTATGTGTATATATACGTGGG - Intergenic
1045744435 8:105400657-105400679 ATTTAGGTATATATTTAGGTTGG + Intronic
1045785937 8:105920270-105920292 GGGTGCATATATATTTAGGATGG - Intergenic
1045922089 8:107543148-107543170 ATGTATATATATTCTTAGTTTGG + Intergenic
1045955822 8:107905395-107905417 GTGTGTTTATATATGTATGTAGG - Intronic
1046004768 8:108465238-108465260 GTGTATATATATCTTTAGTTGGG + Intronic
1046183558 8:110684009-110684031 GTGTACATATATACATATGTAGG - Intergenic
1046197157 8:110880861-110880883 ATATATATATATAGTTAGTTAGG - Intergenic
1046222143 8:111229956-111229978 GTGTATATATATATATTTGAAGG + Intergenic
1046304231 8:112341728-112341750 GTGTATATTTATGTTTAATTCGG - Intronic
1046475849 8:114741814-114741836 TTATATATATATATATATGTTGG - Intergenic
1046500571 8:115071075-115071097 GTGTGTATATATATATATATGGG - Intergenic
1046553203 8:115742979-115743001 ATATATATATATATATAGGCAGG - Intronic
1046653123 8:116861711-116861733 ATGCATATATATATTTATATAGG - Intronic
1046776901 8:118173924-118173946 GAATATATATATATATAGGCTGG - Intergenic
1046929804 8:119830678-119830700 ATGTATGTATATATTTACTTAGG - Intronic
1047029212 8:120858436-120858458 ATATATATATATATATAGCTGGG + Intergenic
1047098707 8:121652840-121652862 GTGTACATATATATGTGTGTAGG - Intergenic
1047538564 8:125742375-125742397 GGGTGCATATATATTTAGGATGG + Intergenic
1047604360 8:126459714-126459736 GGGTGCATATATATTTAGGATGG - Intergenic
1048698897 8:137062456-137062478 GTATATATACATATATAGGAAGG - Intergenic
1048754538 8:137722526-137722548 GTGTATATATATATATATATGGG + Intergenic
1048787520 8:138066088-138066110 GTGTATATATATATATATCAAGG - Intergenic
1048809788 8:138275532-138275554 GTGAATATATAAAATTAGCTGGG + Intronic
1048825926 8:138425960-138425982 ATATATATATATATATATGTTGG - Intronic
1048873766 8:138820699-138820721 ATGAATATATATATGCAGGTAGG - Intronic
1050003693 9:1105203-1105225 GTGTATATATATATATATAAAGG - Intergenic
1050179981 9:2911563-2911585 GTGTGTATATATATGTGGATAGG + Intergenic
1050360744 9:4828613-4828635 AGGTATAAATATATTTAGATTGG + Intronic
1050401842 9:5264222-5264244 GGGTGCATACATATTTAGGTTGG + Intergenic
1050672557 9:8014137-8014159 GTATATATATATATATATGCAGG + Intergenic
1050718477 9:8557444-8557466 ATATATATATATATTTGGGCCGG + Intronic
1050773877 9:9236252-9236274 GTGTATTTATTTATTTATTTTGG - Intronic
1050906018 9:11007003-11007025 GTATATATATATATGTATATGGG + Intergenic
1051019721 9:12528104-12528126 ATATATATATATAATTAGCTGGG - Intergenic
1051238067 9:15022914-15022936 ATATATATATATATATATGTAGG + Intergenic
1051307605 9:15730622-15730644 GTATATATATTTATATAGTTTGG - Intronic
1051425170 9:16925007-16925029 GTGTGTATATATATATATGTGGG + Intergenic
1051863684 9:21654532-21654554 GTGTATAGATAGATTTATTTTGG + Intergenic
1052259717 9:26499916-26499938 ATATATATATATATTTAAGATGG + Intergenic
1052344000 9:27390080-27390102 GTGTATATATATATTTGAGACGG + Intronic
1052405002 9:28048262-28048284 CTGTATTTATAGATTTAGTTGGG - Intronic
1052439683 9:28479889-28479911 GTGTATGTGTATATATACGTAGG + Intronic
1052466563 9:28837641-28837663 ATGTATATATATATTTTAGACGG - Intergenic
1052517977 9:29508573-29508595 GTCTACATAGATATGTAGGTAGG - Intergenic
1052522836 9:29571698-29571720 GTATATATATATATTAAAATAGG + Intergenic
1053409756 9:37908023-37908045 ATATATATATATATATATGTTGG - Intronic
1053564274 9:39231956-39231978 ATATATATATATATATAAGTGGG + Intronic
1053638304 9:40038685-40038707 GTGTATATATATATATAGATGGG - Intergenic
1053767780 9:41426535-41426557 GTGTGTATATATATATAGATGGG + Intergenic
1053795568 9:41723684-41723706 ATGTATATACAAATATAGGTTGG - Intergenic
1053798956 9:41751462-41751484 ATGTATATACAAATATAGGTTGG - Intergenic
1053853503 9:42313996-42314018 ATATATATATATATATAGTTTGG + Intergenic
1054146254 9:61563491-61563513 ATGTATATACAAATATAGGTTGG + Intergenic
1054149616 9:61591192-61591214 ATGTATATACAAATATAGGTTGG + Intergenic
1054183978 9:61935739-61935761 ATGTATATACAAATATAGGTTGG - Intergenic
1054187371 9:61963521-61963543 ATGTATATACAAATATAGGTTGG - Intergenic
1054319097 9:63635284-63635306 GTGTGTATATATATATAGATGGG - Intergenic
1054465986 9:65494582-65494604 ATGTATATACAAATATAGGTTGG + Intergenic
1054469380 9:65522302-65522324 ATGTATATACAAATATAGGTTGG + Intergenic
1054546446 9:66338039-66338061 GTATATATATATATATAGATGGG + Intergenic
1054570721 9:66807642-66807664 ATATATATATATATATAGTTTGG - Intergenic
1054654527 9:67652747-67652769 ATGTATATACAAATATAGGTTGG + Intergenic
1054841043 9:69740179-69740201 GTGTATACATATATGTATATAGG + Intronic
1055089546 9:72348737-72348759 ATATATATATATATATAGGAAGG + Intergenic
1055093657 9:72388269-72388291 ATATATATATATATATAGCTGGG + Intergenic
1055254167 9:74346264-74346286 GTGTGTATATATATATATGATGG - Intergenic
1055354229 9:75420820-75420842 GTGTCTATGTATATTTAGATAGG - Intergenic
1055370280 9:75591061-75591083 CTGTTTATATATTTTTAGGTTGG + Intergenic
1055926086 9:81511238-81511260 ATATATATATATAATTAGCTGGG - Intergenic
1055932050 9:81569144-81569166 ACGTATATATGTATATAGGTAGG + Intergenic
1056022460 9:82454338-82454360 GTATATATATGTATGTATGTAGG - Intergenic
1056163004 9:83916608-83916630 GTTTATATATATTTTTAGCCAGG - Intronic
1056289753 9:85131049-85131071 GTGTGTATATATATATATGATGG - Intergenic
1056945995 9:90997350-90997372 GTATATATATATATGCATGTAGG - Intergenic
1057540437 9:95963445-95963467 GTTTTTATGTATATTTAAGTAGG - Intronic
1057766772 9:97927152-97927174 GTGTGTATGTATGTATAGGTCGG - Exonic
1057996876 9:99827286-99827308 GTGTGTATATATATATATATGGG + Intronic
1057996878 9:99827290-99827312 GTATATATATATATATGGGTGGG + Intronic
1058035183 9:100244466-100244488 CTGTATATATATATTAAATTTGG - Intronic
1058257048 9:102779552-102779574 ATATATATATATATATATGTTGG + Intergenic
1058441711 9:105014508-105014530 GGGTGCATATATATTTAGGATGG + Intergenic
1059048958 9:110901980-110902002 GTTTATATTTATACTTAGCTGGG - Intronic
1059127468 9:111705154-111705176 GTGTGTATATATATTCTGATAGG - Intronic
1059208885 9:112492544-112492566 ATGTATGTACATATGTAGGTAGG - Intronic
1060055481 9:120409365-120409387 CTGTATTTATATAATAAGGTTGG - Intronic
1060458740 9:123827401-123827423 ATATATATATATATATAGGTGGG + Intronic
1060805557 9:126573794-126573816 GTATATATATATATTTGGCTGGG - Intergenic
1060907826 9:127323754-127323776 GTATATATATATATTTATGGGGG - Intronic
1060907828 9:127323756-127323778 GTGTATATATATATATTTATGGG - Intronic
1060916063 9:127391536-127391558 ATATATATATATATATAGGCTGG + Intronic
1060951201 9:127604543-127604565 ATATATATATATATTTGGCTGGG + Intergenic
1061102702 9:128504384-128504406 ATATATATATATATTTACCTAGG + Intergenic
1061128739 9:128694106-128694128 GTATATATATATATATAGTGTGG + Intronic
1061156517 9:128865304-128865326 ATATATATATATATATATGTAGG - Intronic
1061956466 9:133964305-133964327 GTGTATATATATATATATCAGGG - Intronic
1202799105 9_KI270719v1_random:157361-157383 GTATATATACATATATATGTGGG + Intergenic
1203754847 Un_GL000218v1:116361-116383 GTATATATATATGTATAGGCTGG + Intergenic
1203714233 Un_KI270742v1:128921-128943 ATATATATATATATATAGGCTGG + Intergenic
1185451448 X:282722-282744 GTGTATATAACTTTTTTGGTTGG - Intronic
1185454303 X:300706-300728 GTGTATATATATATTTTTTGAGG + Exonic
1185488676 X:502128-502150 GTGTATATGTGTATTTAGTGTGG - Intergenic
1185510780 X:662819-662841 GTGTATATGTGTATATATGTGGG + Intergenic
1186010771 X:5130491-5130513 GTCTATATCTATATATAGATAGG + Intergenic
1186012155 X:5146422-5146444 ATGTGTATATATTTTTATGTAGG + Intergenic
1186130064 X:6456656-6456678 GTATATATATATATGGGGGTGGG + Intergenic
1186360839 X:8839691-8839713 GTATAAATATATAAGTAGGTAGG - Intergenic
1186810900 X:13187650-13187672 ATGTATATATATATATGGTTTGG + Intergenic
1186821962 X:13297948-13297970 GTGTATACAAATATTATGGTGGG - Intergenic
1187065615 X:15834431-15834453 ATATATATATATATTTTGGAAGG - Intronic
1187134848 X:16537861-16537883 ATATATATATATATTTGGATGGG - Intergenic
1187208733 X:17208196-17208218 ATATATATATATAATTAGCTAGG + Intergenic
1187544602 X:20236082-20236104 ATGTATATATTTATTTAGAATGG - Intronic
1188049849 X:25471388-25471410 ATATATATATATATATATGTGGG - Intergenic
1188169642 X:26909048-26909070 ATATATATATATATATATGTAGG - Intergenic
1188351048 X:29131274-29131296 GTATATATATATATATATGCTGG + Intronic
1188453384 X:30333941-30333963 GTATATATATGTATATATGTAGG - Intergenic
1188453389 X:30334051-30334073 GTATATATGTATATATATGTAGG - Intergenic
1188453391 X:30334097-30334119 GTATATATGTATATATATGTAGG - Intergenic
1188453397 X:30334249-30334271 GAATATATATATATATATGTAGG - Intergenic
1188625540 X:32279981-32280003 GGGTACATATATATATATGTGGG - Intronic
1188680581 X:32998596-32998618 GTGTATATATATATATAAATAGG - Intronic
1188704588 X:33311154-33311176 GTGTATCTATATATTAAAGTAGG - Intronic
1188971991 X:36629359-36629381 ATATATATATATATATAGGTGGG + Intergenic
1188982381 X:36738648-36738670 ATATATATATATATTTATGAGGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189141224 X:38608276-38608298 ATATATATATATTTTTTGGTGGG - Intronic
1189429355 X:40933181-40933203 CTGTACATATCTATTTTGGTCGG + Intergenic
1189435228 X:40987011-40987033 GTGTATATGTATATATGTGTGGG + Intergenic
1189485998 X:41432532-41432554 GTGTATATATATATTTTTTGAGG - Intergenic
1189668491 X:43382826-43382848 GTATATATATATATATATGATGG + Intergenic
1189831064 X:44973510-44973532 CTGGATATATAATTTTAGGTTGG + Intronic
1189950812 X:46228849-46228871 ATATATATATATATATAGCTGGG + Intergenic
1190555515 X:51630580-51630602 ATATATATATATATATATGTAGG + Intergenic
1190606484 X:52148826-52148848 GGGTGCATATATATTTAGGATGG + Intergenic
1190789783 X:53687520-53687542 GTGTAAGTATATATTGGGGTGGG - Intergenic
1190878897 X:54478829-54478851 GTGTATATACAGTTTTACGTTGG - Intronic
1191039489 X:56064155-56064177 GTGTATATATATATATATGCAGG + Intergenic
1191131506 X:57017515-57017537 GTGTACATATATACTTATATAGG + Intergenic
1191168313 X:57415916-57415938 GGGTGCATATATATTTAGGATGG + Intronic
1191180664 X:57559810-57559832 GGGTGCATATATATTTAGGATGG - Intergenic
1191722554 X:64246449-64246471 GTGTGTGTATATATTTATGAAGG + Intergenic
1191722556 X:64246453-64246475 GTGTATATATTTATGAAGGGTGG + Intergenic
1191745459 X:64482059-64482081 GGGTGCATATATATTTAGGTTGG + Intergenic
1191825299 X:65358147-65358169 GGGTGCATATATATTTAGGATGG - Intergenic
1191858869 X:65649673-65649695 GTGTATATATATATAAAATTGGG + Intronic
1192565806 X:72162526-72162548 ATATATATATATATATAGCTGGG + Intergenic
1192616476 X:72628573-72628595 ATATATATATATATTTATATGGG - Intronic
1192657556 X:73007776-73007798 ATATATATATATATATATGTAGG - Intergenic
1192712395 X:73605190-73605212 GGGTGCATATATATTTAGGATGG + Intronic
1192820720 X:74642464-74642486 GTATATATATATATATATGATGG + Intergenic
1192899009 X:75474430-75474452 GTGTATATATATATATATAAAGG - Intronic
1192929302 X:75788148-75788170 GTTTATGTGTATATTTATGTTGG + Intergenic
1193014476 X:76717029-76717051 TTGTATAAAAGTATTTAGGTGGG + Intergenic
1193129281 X:77902848-77902870 GTGTACATATCTAGTTAGGAGGG + Intronic
1193398825 X:81018232-81018254 GGGTACATATATATTTAGGATGG + Intergenic
1193447491 X:81621511-81621533 GTGTATATATATATATAAAGGGG - Intergenic
1193591856 X:83398223-83398245 GGGTGTATATATATTTAGGATGG - Intergenic
1193618015 X:83713687-83713709 GTGTGTATATATATCTATGTTGG + Intergenic
1193814575 X:86089664-86089686 GTGTATATATATATATAGTATGG - Intergenic
1193891549 X:87051644-87051666 GTGTGTATATATATATAAATAGG - Intergenic
1194107542 X:89790398-89790420 GTATATATATATATATATATAGG - Intergenic
1194276493 X:91890855-91890877 TTGTTTATATATACATAGGTAGG - Intronic
1194279427 X:91930490-91930512 GTATATATATATATTTGGAGAGG - Intronic
1194525766 X:94975977-94975999 GGGTGCATATATATTTAGGATGG + Intergenic
1194701912 X:97124806-97124828 GTGTATATATGTATATACATGGG + Intronic
1194759675 X:97780660-97780682 GTATAAATATATATTTTGCTTGG + Intergenic
1194814998 X:98430425-98430447 TTGTATATATGTATGTAGGTAGG - Intergenic
1194837233 X:98696792-98696814 GGGTGCATATATATTTAGGATGG + Intergenic
1194868992 X:99103912-99103934 ATATATATATATATATATGTGGG + Intergenic
1194970230 X:100334860-100334882 GTATATATATATATATATGTTGG + Intronic
1195354918 X:104030567-104030589 GGGTGCATATATATTTAGGATGG + Intergenic
1195419404 X:104656866-104656888 GGGTGCATATATATTTAGGATGG + Intronic
1195434449 X:104826801-104826823 GGGTGCATATATATTTAGGATGG + Intronic
1195592173 X:106642135-106642157 AGGTATATATATATTTATGGGGG + Intronic
1195604657 X:106791386-106791408 GAATATATGTATATTAAGGTAGG - Intronic
1196205771 X:112937711-112937733 ATGTATATATATATTTAGCCGGG + Intergenic
1196219353 X:113093895-113093917 GTGTATATATATATATATAGTGG + Intergenic
1196409746 X:115403796-115403818 ATGTATATATACATATATGTAGG - Intergenic
1196409747 X:115403822-115403844 ATGTATATATACATATATGTAGG - Intergenic
1196409748 X:115403848-115403870 ATGTATATATACATATATGTAGG - Intergenic
1196434367 X:115661533-115661555 ATATATATATATATTTAGCTGGG + Intergenic
1196466821 X:115980596-115980618 TTATATATATATATATAGGCTGG - Intergenic
1196484324 X:116187190-116187212 TTTTATATATATATATATGTTGG - Intergenic
1196492429 X:116283939-116283961 GTGTGTATATATATATATATAGG - Intergenic
1196492433 X:116284043-116284065 GTGTATATATATATATATATAGG + Intergenic
1196518048 X:116637117-116637139 ATATATATATATATTTTGTTTGG - Intergenic
1196559135 X:117125119-117125141 GGGTACATATATACTTAGGATGG - Intergenic
1196744574 X:119058533-119058555 GTATATATACATATTTGGTTTGG + Intergenic
1196755905 X:119156800-119156822 GTGTATATATACATACATGTAGG - Intergenic
1197018244 X:121653878-121653900 GTGTGTATATATATATACATAGG - Intergenic
1197103322 X:122682639-122682661 ATATATATATATATATATGTGGG - Intergenic
1197196128 X:123702631-123702653 ATGTATATATATATTTTAGCAGG + Intronic
1197215352 X:123861685-123861707 GTTGATATATATATTTGTGTGGG - Intronic
1197589356 X:128389687-128389709 GTGTGTATATATATATATGATGG + Intergenic
1197665638 X:129220549-129220571 ATGTATGTATATATGTATGTGGG - Intergenic
1197722922 X:129756991-129757013 ATATATATATATATATAGCTGGG - Intronic
1198012952 X:132577955-132577977 GTGTGTATACATATTTATGTAGG + Intergenic
1198244916 X:134821086-134821108 GTGTATATATATATATATATGGG + Intronic
1198539514 X:137621846-137621868 ATATATATATATATTTAATTGGG + Intergenic
1198602478 X:138298725-138298747 ATATATATATATATTTGGGAAGG - Intergenic
1198602479 X:138298729-138298751 GTATATATATATATATATTTGGG - Intergenic
1198852268 X:140977528-140977550 GTGTATATATACACATATGTAGG + Intergenic
1198965168 X:142220816-142220838 GTGTATATATATATTTAAACAGG + Intergenic
1199023979 X:142916335-142916357 ATATATATATATATATATGTAGG - Intergenic
1199085594 X:143626503-143626525 GTGTGTATATATATATATGTGGG - Exonic
1199088233 X:143657050-143657072 GTGTGTGTATATATATAGGTAGG - Intergenic
1199137337 X:144268161-144268183 GGGTGCATATATATTTAGGATGG - Intergenic
1199168906 X:144712391-144712413 GTATATATATATATGAAGGCAGG - Intergenic
1199179608 X:144838358-144838380 GTGTATATATATATATATGATGG - Intergenic
1199211863 X:145221914-145221936 GTTTATTTATTTATTTTGGTGGG + Intergenic
1199363408 X:146948550-146948572 GTGTGTGTATATATATATGTTGG + Intergenic
1199473058 X:148216410-148216432 GTATACATATGTATATAGGTGGG - Intergenic
1199511104 X:148623607-148623629 ATATATATATATATTTAACTTGG + Intronic
1199907514 X:152248705-152248727 ATGCATATTTATAATTAGGTAGG + Intronic
1200370200 X:155716996-155717018 ATATATATATATATATAGCTGGG + Intergenic
1200593792 Y:5112640-5112662 TTGTTTATATATACATAGGTAGG - Intronic
1200596904 Y:5153988-5154010 GTATATATATATATTTGGAGAGG - Intronic
1200786949 Y:7269157-7269179 GTGTGTATATATATATATATGGG - Intergenic
1200871581 Y:8104943-8104965 GTGAATAGGTATTTTTAGGTTGG + Intergenic
1201599081 Y:15708071-15708093 GTGTGTATATATATATCTGTGGG + Intergenic
1201622117 Y:15971284-15971306 GTGTGTATATATATATATTTAGG + Intergenic
1201857582 Y:18561991-18562013 TTTTAAAGATATATTTAGGTGGG + Intronic
1201875739 Y:18758390-18758412 TTTTAAAGATATATTTAGGTGGG - Intronic
1201905008 Y:19078564-19078586 GTGTGTATATATATATAGATGGG + Intergenic
1202188099 Y:22209582-22209604 ATATATATATATATATATGTTGG + Intergenic
1202194180 Y:22279230-22279252 GTGTGTATATATATATTTGTGGG + Intergenic
1202330414 Y:23746168-23746190 ATGTATATATATATGTATATTGG + Intergenic
1202540355 Y:25923893-25923915 ATGTATATATATATGTATATTGG - Intergenic
1202590914 Y:26482242-26482264 ATATATATATATAATTAGCTGGG - Intergenic