ID: 1067917670

View in Genome Browser
Species Human (GRCh38)
Location 10:50418273-50418295
Sequence AGCGCCGCTGTCCTAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067917670_1067917680 12 Left 1067917670 10:50418273-50418295 CCTGGTGCTAGGACAGCGGCGCT 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1067917680 10:50418308-50418330 GTCTGGAGCTGGCGGGCGGCCGG 0: 1
1: 0
2: 5
3: 31
4: 284
1067917670_1067917679 8 Left 1067917670 10:50418273-50418295 CCTGGTGCTAGGACAGCGGCGCT 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1067917679 10:50418304-50418326 CGGCGTCTGGAGCTGGCGGGCGG 0: 1
1: 0
2: 3
3: 22
4: 202
1067917670_1067917675 4 Left 1067917670 10:50418273-50418295 CCTGGTGCTAGGACAGCGGCGCT 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1067917675 10:50418300-50418322 AGCCCGGCGTCTGGAGCTGGCGG 0: 1
1: 0
2: 4
3: 20
4: 206
1067917670_1067917676 5 Left 1067917670 10:50418273-50418295 CCTGGTGCTAGGACAGCGGCGCT 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1067917676 10:50418301-50418323 GCCCGGCGTCTGGAGCTGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 200
1067917670_1067917673 -5 Left 1067917670 10:50418273-50418295 CCTGGTGCTAGGACAGCGGCGCT 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1067917673 10:50418291-50418313 GCGCTGCGGAGCCCGGCGTCTGG 0: 1
1: 0
2: 1
3: 13
4: 116
1067917670_1067917674 1 Left 1067917670 10:50418273-50418295 CCTGGTGCTAGGACAGCGGCGCT 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1067917674 10:50418297-50418319 CGGAGCCCGGCGTCTGGAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067917670 Original CRISPR AGCGCCGCTGTCCTAGCACC AGG (reversed) Intronic
909613834 1:77583626-77583648 AGGGCTGCTCTCCTAACACCTGG + Intronic
913214766 1:116610992-116611014 AGAGCCCCAGTCCTAGCCCCTGG + Intronic
1067917670 10:50418273-50418295 AGCGCCGCTGTCCTAGCACCAGG - Intronic
1070774668 10:79102675-79102697 AGCAGTGCTGGCCTAGCACCAGG + Intronic
1073178410 10:101570091-101570113 AGCTCCGCTGTCTCAGCTCCCGG + Intergenic
1081927833 11:46845758-46845780 GGTGCCGCTGTCCTTGCTCCAGG + Intronic
1084180577 11:67443629-67443651 AGAGCCCCTTTCCTAGGACCCGG + Intronic
1086251115 11:84815469-84815491 ACCGAAGCTATCCTAGCACCTGG + Intronic
1096053091 12:48628367-48628389 AGCACCTCTGTCCTGGCAGCAGG + Intergenic
1096487626 12:51994418-51994440 AGCGCCCCTGTCATGGCTCCTGG - Intronic
1104671048 12:130680572-130680594 AGAGCCGCGGTCCTAGAAGCAGG - Intronic
1117336943 14:54764021-54764043 AACGCCGCTGTCTCTGCACCTGG + Intronic
1120882938 14:89428750-89428772 AGCGCAGGGGTCCAAGCACCTGG + Intronic
1121727178 14:96161191-96161213 AGAGCCTCTGTCCTTGAACCTGG - Intergenic
1130517154 15:84634110-84634132 AGCGCCGCCGTCCAGGGACCGGG + Intergenic
1131260196 15:90884096-90884118 AGGCGCGCAGTCCTAGCACCAGG - Intronic
1132468012 16:86528-86550 AGCCCCGCTGTCCTTGCCCCTGG - Exonic
1137840760 16:51638847-51638869 AGCCCCACTGTCCCAGCAGCAGG - Intergenic
1138382068 16:56609350-56609372 AGCGGGGCTGTCCCAGCATCAGG - Exonic
1138393073 16:56684045-56684067 AGCACAGCTGTCCTGGCATCAGG - Exonic
1151803084 17:76389106-76389128 AGAGCCGACGTCATAGCACCTGG - Intergenic
1157550201 18:48576071-48576093 GGCGCCGCTGCCCGAGGACCGGG - Intronic
1161218245 19:3105424-3105446 AGCGCCGCTGTCTATGTACCAGG - Intronic
1161874100 19:6894260-6894282 TGAGCCTCTTTCCTAGCACCTGG + Intronic
1162798536 19:13098873-13098895 TGCGCCTCTGTCCAAGCGCCGGG + Intergenic
1165738773 19:38193615-38193637 AGCCCCGCTGGCCTAGAGCCAGG + Exonic
936723490 2:115283146-115283168 AGCCCCGCTGTCTTTGCACTTGG - Intronic
943624252 2:190180904-190180926 GGCGCCGCTGCCCTGGCAGCTGG + Exonic
948809604 2:240467851-240467873 AGTGCTGCTGTCCTGGCGCCCGG - Exonic
1171154788 20:22862066-22862088 AGCGCCGCTCCCCTGGCTCCAGG - Intergenic
1173372357 20:42448382-42448404 AGCCCCGCTGACCTAGAACAGGG + Intronic
1176132754 20:63503165-63503187 AGCGCCCCTGTGCTGGCACCAGG - Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176515107 21:7777940-7777962 AGAACCCCTGTCCTAGAACCAGG + Intergenic
1178649135 21:34407952-34407974 AGAACCCCTGTCCTAGAACCAGG + Intergenic
1180997954 22:19974795-19974817 AGGGCAGCTGCCCTAGCAACAGG + Intronic
955998988 3:64708658-64708680 TGCACCACTCTCCTAGCACCCGG + Intergenic
956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG + Intergenic
960630609 3:119726741-119726763 AGCGCCACTGTCCCAGTGCCTGG + Intronic
961403450 3:126663195-126663217 ACTGCCTCTGTCCTAGCACGAGG + Intergenic
961625663 3:128261968-128261990 AGCACCACTGTACTAGCACATGG - Intronic
970173184 4:13309177-13309199 TGGGCCGCGGTCCTAGCTCCAGG - Intergenic
985023596 4:185717141-185717163 AGCGCCGCTGTCTTCAAACCTGG + Intronic
985251907 4:188032768-188032790 AGCGCAGCTCTCCCAGCGCCAGG - Intergenic
1006582370 6:35084337-35084359 TGCGGCGCTGTCCTGGCCCCTGG + Intronic
1018210341 6:161475223-161475245 ATCGCTGCTGTCCTATCAACTGG + Intronic
1018232452 6:161688610-161688632 TGCGCCGCTATACTAGTACCTGG - Intronic
1019623304 7:2002983-2003005 TGCGGCTCTGTCCTAGAACCTGG + Intronic
1034275611 7:149822558-149822580 AGCGCTGCTGCACCAGCACCCGG - Intergenic
1034956523 7:155338668-155338690 CGCGCCTCTGTCCTGGCTCCAGG - Intergenic
1045369904 8:101512896-101512918 AGCCCCTCTGTGCTGGCACCCGG - Intronic
1048043964 8:130755954-130755976 AGTGCCACTTTCCTAGCAGCTGG - Intergenic
1049173186 8:141174733-141174755 AGCGCCGCTGCCCTGCCACTGGG - Intronic
1056434052 9:86558116-86558138 AGCGCAGCTGTCGGAGCAGCTGG - Intergenic
1059942134 9:119369004-119369026 AGCCCCGCTGCCCTTGGACCCGG - Intronic
1060872114 9:127050866-127050888 AGGGCAGCTTTCCTAGGACCTGG - Intronic
1062452033 9:136619864-136619886 AGCGCCGCTGGCCCAGGCCCTGG - Intergenic
1190875214 X:54455467-54455489 AGCGCTGCTTTCCTGACACCAGG + Exonic
1192447945 X:71224495-71224517 TGCGCCGCAGCCCTGGCACCGGG + Exonic
1193724140 X:85020525-85020547 AGCCCACCTGTTCTAGCACCAGG + Intronic
1200135766 X:153873873-153873895 AGAGCTGCTGTCCCAGCCCCAGG + Intronic