ID: 1067918981

View in Genome Browser
Species Human (GRCh38)
Location 10:50433748-50433770
Sequence GAGCAGTATTTCCACTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067918980_1067918981 0 Left 1067918980 10:50433725-50433747 CCTTAAGAGAAAAAAAATTTTAA 0: 1
1: 1
2: 38
3: 285
4: 2210
Right 1067918981 10:50433748-50433770 GAGCAGTATTTCCACTATGAAGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067918981 Original CRISPR GAGCAGTATTTCCACTATGA AGG Intronic
901128345 1:6945110-6945132 GAGCAGTATTTGGCATATGATGG + Intronic
905260351 1:36713263-36713285 GATCAGTTTGTCCATTATGATGG - Intergenic
909628269 1:77743741-77743763 GTGCATTATTTCCTCTATTATGG - Intronic
911169281 1:94754291-94754313 GAGCTGGATTTCCAGTAAGAGGG + Intergenic
911303841 1:96208733-96208755 GGGCAATATTTCAAATATGATGG + Intergenic
911438470 1:97894253-97894275 AAGCACTAATCCCACTATGAGGG + Intronic
916350817 1:163847913-163847935 GAGCACTAATCCCAGTATGAGGG + Intergenic
917360423 1:174169406-174169428 TAGTAGTATTTTCACTATGTTGG + Intronic
919111322 1:193222493-193222515 GAGTAGTATTTTCAATGTGATGG - Intronic
919254344 1:195102126-195102148 GAGTAGTATTTACACCATGATGG + Intergenic
921954130 1:220964522-220964544 GGGCACTAATTCCATTATGAAGG + Intergenic
924493988 1:244568625-244568647 CAGCTTTATTTCCACTGTGAGGG + Intronic
1063058964 10:2530889-2530911 GAGCACTAATCCCATTATGAGGG + Intergenic
1066264118 10:33758731-33758753 GAGCAGGACTTCAACTAGGAAGG + Intergenic
1067798511 10:49338860-49338882 GTGAGGTATTTCCACTCTGATGG - Intergenic
1067918981 10:50433748-50433770 GAGCAGTATTTCCACTATGAAGG + Intronic
1069282308 10:66670130-66670152 GAGTAATATGTCCACTATGGGGG + Intronic
1071070037 10:81681128-81681150 GACCAGTATTTCCACTAAAGGGG + Intergenic
1072358951 10:94640129-94640151 GAGCTTTGTTTGCACTATGAGGG + Intergenic
1074072605 10:110087410-110087432 TAACAGTGTTTCCGCTATGATGG + Intronic
1078138102 11:8669278-8669300 CAGCAGTATTGACAGTATGAAGG - Intronic
1080669429 11:34362655-34362677 GAGAAGTTTTTCCAAAATGATGG + Intergenic
1081792900 11:45801568-45801590 GAGCACTAATCCCACCATGAGGG - Intergenic
1082880080 11:58028586-58028608 GTGCAGTATCTCCACTGGGAAGG + Intronic
1085224356 11:74906185-74906207 GAAGTGTATTTCCACCATGAGGG + Intronic
1087102411 11:94378751-94378773 GAGCAGGCTTTCCAATATGCTGG - Exonic
1087419699 11:97906301-97906323 GTGCAGTATTTCCACCATTTTGG + Intergenic
1088218188 11:107537194-107537216 GTGCAGTGTTTCCACTATTCTGG + Intronic
1088615516 11:111623558-111623580 GAGCACTGTTTCAATTATGAAGG - Intronic
1089054390 11:115573585-115573607 GTGCAGTATTTCCACTGTTCTGG + Intergenic
1092997235 12:13961954-13961976 GAGCAGCATTTCAAATATGCTGG + Intronic
1093182079 12:15978028-15978050 GAGCAGGTTTTCCCCTATGTTGG - Intronic
1099226314 12:79973570-79973592 GATCAGTATCTCCACTGTAAAGG - Intergenic
1101652920 12:106694106-106694128 TTGCAGTATTTCCACTGTCAGGG + Intronic
1101865990 12:108519784-108519806 GAGCAGAATTTGCACTAAGGTGG + Exonic
1104349052 12:128029102-128029124 GAGCAGTCTTTCCATTCCGAAGG - Intergenic
1105216773 13:18291579-18291601 AAGCAGTATTTCCAGGCTGAAGG - Intergenic
1105529748 13:21208635-21208657 GAGCATTAATCCCATTATGAGGG - Intergenic
1106778850 13:33035396-33035418 AAGCAGTTTTTCCTCTATAATGG - Intronic
1107051844 13:36059034-36059056 GAGCAGTATTTTTCCTATAAAGG - Intronic
1107504083 13:41013260-41013282 GAGCAGTATCTTCACATTGAGGG - Intronic
1108976034 13:56444040-56444062 GAGCAGTAATTCATTTATGAGGG + Intergenic
1110973987 13:81806263-81806285 GAGCAGTATTGCCACAAAGAGGG + Intergenic
1114856663 14:26454553-26454575 GAGTTGTATTTCCTCTGTGATGG - Intronic
1115885006 14:37961507-37961529 CAGCAGCATTTCCATTATGATGG - Intronic
1116095499 14:40361828-40361850 GAGCATAATTTCCATTTTGAGGG + Intergenic
1118705546 14:68477205-68477227 GCCCAATACTTCCACTATGATGG - Intronic
1119123532 14:72101831-72101853 AAGCAGTAATTCCCCTATGAGGG - Intronic
1119591885 14:75897133-75897155 GAGCATTATTCCTACTCTGAGGG - Intronic
1119855739 14:77899184-77899206 GAGCTGGATTTCCTCAATGAAGG + Exonic
1121006242 14:90492268-90492290 CAGCACTAATTCCACTGTGAGGG - Intergenic
1121876244 14:97456216-97456238 CAGCACCATTTCCACCATGATGG + Intergenic
1124628098 15:31321226-31321248 GGACACTAATTCCACTATGAGGG + Intergenic
1125187871 15:36952877-36952899 GAGCTGTACTTTCACTATGAAGG + Intronic
1126678334 15:51181260-51181282 GAAAATTATTTCCAATATGAGGG - Intergenic
1128652037 15:69423808-69423830 AAGTAGTATTTCAACTCTGATGG - Intronic
1129739119 15:77981483-77981505 GAGAAGTACTTCCTCAATGATGG + Intergenic
1130819996 15:87485089-87485111 TAGCAGTGTTTGCACTATAATGG + Intergenic
1132109034 15:99088646-99088668 GCACAGTATTTCCATTTTGATGG + Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1137812843 16:51369405-51369427 GAGTATCTTTTCCACTATGAGGG - Intergenic
1137908000 16:52345064-52345086 GAGTAGGATTCCCACTATAATGG - Intergenic
1138609987 16:58115260-58115282 GAGCAGTACCTGCACTCTGAGGG + Exonic
1140036825 16:71377590-71377612 GAGCAGATTTTCCCCTAAGAAGG - Intronic
1147149819 17:38508368-38508390 GGGCTGTATTTCCACAGTGAGGG + Intronic
1148990706 17:51664514-51664536 GAGAAGTAATTCCACTAAAATGG - Intronic
1155790825 18:29968554-29968576 GTGCAGTATTTCCATTATACTGG - Intergenic
1157055802 18:44227165-44227187 GAGCAGGAATTCCACCATCAGGG + Intergenic
1159856665 18:73597649-73597671 GAGCATGATTCCCACTCTGAAGG + Intergenic
1160130892 18:76223892-76223914 GAGCATTAATCCCGCTATGAGGG - Intergenic
1161944060 19:7423511-7423533 GAGAAGGATTTTCACTATGTTGG - Intronic
1166228933 19:41414320-41414342 GGGCAGTCTTCCCACTCTGAAGG + Intronic
1168351944 19:55680964-55680986 GAGCAGTCTTTCCACTTTGATGG + Intronic
931173384 2:59828843-59828865 AAGCTGTATTTCCTCTTTGAGGG + Intergenic
935396275 2:102612645-102612667 CATCAGTATTTACACTAAGATGG - Intergenic
936001826 2:108839895-108839917 CAGCAGTATGTCGAATATGATGG + Intronic
939716312 2:145588400-145588422 GACCATTTTTTCCATTATGATGG + Intergenic
939771504 2:146325526-146325548 TAGCAGAATTTCTACTATAAAGG - Intergenic
944684046 2:202102531-202102553 GAGCAAGCTTTCCACTAAGAAGG - Intronic
944938058 2:204590252-204590274 GGGCACTAATTCCATTATGAGGG + Intronic
945280649 2:208032491-208032513 GAACAGTAATTACACTATGTTGG - Intergenic
945549411 2:211201016-211201038 CAGCAGTATTTCCAGTTTCATGG + Intergenic
945704881 2:213217777-213217799 GAGCAGGATCTCCACAATAAGGG + Intergenic
946500926 2:220246260-220246282 GGGCACTAATTCCACCATGAGGG - Intergenic
1169309582 20:4523730-4523752 GAGCTTTATATCCACTATGATGG + Intergenic
1172082123 20:32350302-32350324 GAGGAGTCTTTCCTCTAGGATGG + Intergenic
949196360 3:1313934-1313956 GAACACTAATCCCACTATGAAGG + Intronic
950060363 3:10066232-10066254 GAACAGTAGTTCCACAGTGAAGG - Intronic
952746043 3:36781317-36781339 GTTCAGTAGTTTCACTATGATGG + Intergenic
955426198 3:58793474-58793496 TAGTAGTATTTCCAAAATGAAGG + Intronic
957669031 3:83276706-83276728 AATCAGTTTTTCCACTATGAGGG + Intergenic
957794232 3:84982447-84982469 GATCAGTATTTCTACAAAGAAGG + Intronic
958995992 3:100905640-100905662 GTGCAGCATTTCCACTATTCTGG + Intronic
960838210 3:121929125-121929147 GAACAGTATCTCCAGCATGATGG + Exonic
963171841 3:142258918-142258940 CTTCAGTATTTCTACTATGATGG - Intergenic
964912910 3:161803535-161803557 TAGCAGTATTTTCTCTAAGAAGG - Intergenic
965601020 3:170454666-170454688 GAGGAGTGTCTCCACTAGGAAGG + Intronic
970847073 4:20553287-20553309 GAGAAGTATTTACAAGATGATGG - Intronic
974943723 4:68500940-68500962 GAACAGTATTTCCTTCATGAAGG + Intergenic
974985648 4:69023159-69023181 GAGCAATATTGCCACTCTGCTGG - Intronic
977910503 4:102529404-102529426 AATCAGTATTTCCTCTATGGTGG - Intronic
980867168 4:138565574-138565596 GAGCAGCCTTTCCAAAATGAGGG - Intergenic
981225364 4:142288015-142288037 GAGCACTAATCCCACCATGAGGG + Intronic
981949791 4:150392430-150392452 GAGCACTAATTCCATCATGACGG + Intronic
987141723 5:14953357-14953379 GAACAGTCTCTGCACTATGAGGG + Intergenic
987301742 5:16603673-16603695 GAGCACTACTGCCACTCTGAGGG - Intronic
990703481 5:58500616-58500638 GAGCACTAATTCCATCATGAGGG - Intergenic
994117243 5:96074375-96074397 GGGCACTAATTCCATTATGAAGG - Intergenic
995118013 5:108503649-108503671 GTGCATTATTTTCACTATCATGG + Intergenic
1004002872 6:11611506-11611528 GTGCAGTATTTCCACTGTTCTGG + Intergenic
1005962308 6:30703055-30703077 GAGCAGTCTTGCCACTATATCGG + Intronic
1007758505 6:44116979-44117001 GTGCAGTTTTTCCTCTATGGAGG - Intronic
1010377128 6:75183917-75183939 GATCAGTGTTTCCGCCATGAAGG - Exonic
1010400235 6:75440421-75440443 GAAGAGAATTTTCACTATGAAGG + Intronic
1012121424 6:95372021-95372043 GAGCAGGGTTTCCACCATGCTGG + Intergenic
1013669365 6:112382434-112382456 CAGCAGGTTTTCCACTATGCTGG - Intergenic
1016730994 6:147427448-147427470 GAGTAGTATTTCTCCTATGAAGG - Intergenic
1017610669 6:156183062-156183084 GAGTATTATTTCCACTACGTAGG - Intergenic
1020556549 7:9677513-9677535 GGGCATTAATCCCACTATGAGGG - Intergenic
1021015951 7:15533615-15533637 GAGCAGTATTTTCACCATGGTGG + Intronic
1023670939 7:42575921-42575943 AAGAAGTATTTCCTCTATAATGG + Intergenic
1024524124 7:50333771-50333793 GAACAATAATTCAACTATGAAGG - Intronic
1031495274 7:122439263-122439285 GAGCAGTTTTATCATTATGAAGG - Intronic
1033152227 7:138925365-138925387 GAGCTTTATTTGCACCATGAGGG - Intronic
1038075241 8:24065906-24065928 GAGCATGGTTTCCACTATTATGG - Intergenic
1042961518 8:74308743-74308765 GAGGAAAACTTCCACTATGAAGG + Intronic
1044493480 8:92848479-92848501 CAGCAGTATTCCTACTATCAAGG + Intergenic
1045630765 8:104118903-104118925 GAGCAGTAATCCCATCATGAGGG + Intronic
1046257072 8:111714470-111714492 GTGCAGTATTTACCCTGTGACGG - Intergenic
1047664560 8:127076390-127076412 GAACACTAATTCCATTATGAGGG - Intergenic
1051231800 9:14962853-14962875 GAGTAGTCTTTCTACTGTGAAGG - Intergenic
1052196704 9:25725550-25725572 GAGCAGTATTTCCCTTAAAAAGG - Intergenic
1054988477 9:71291720-71291742 TATCAGAACTTCCACTATGAGGG - Intronic
1060397864 9:123328692-123328714 CAGCAGTATTTCCTTTTTGAGGG - Intergenic
1189729668 X:44005875-44005897 GAGCAGCATTTCCACTGTTCTGG - Intergenic
1193841745 X:86415766-86415788 GTGCAGCATTTCCAGTAAGAGGG + Intronic
1197188058 X:123610205-123610227 GAACACTGTATCCACTATGATGG + Intronic
1201498219 Y:14613075-14613097 GAGGCTTATTTACACTATGAGGG + Intronic