ID: 1067921599

View in Genome Browser
Species Human (GRCh38)
Location 10:50464315-50464337
Sequence CTGACTTTAAAGATGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067921595_1067921599 -9 Left 1067921595 10:50464301-50464323 CCATTTGACCACTGCTGACTTTA 0: 1
1: 0
2: 3
3: 18
4: 221
Right 1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067921599 Original CRISPR CTGACTTTAAAGATGGAAAA GGG Intronic
No off target data available for this crispr