ID: 1067925461

View in Genome Browser
Species Human (GRCh38)
Location 10:50504007-50504029
Sequence ACATGCTTATAAAACACGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067925461_1067925462 2 Left 1067925461 10:50504007-50504029 CCTCTCGTGTTTTATAAGCATGT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1067925462 10:50504032-50504054 TACCTGCATCGATATGAGAGAGG No data
1067925461_1067925464 18 Left 1067925461 10:50504007-50504029 CCTCTCGTGTTTTATAAGCATGT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1067925464 10:50504048-50504070 AGAGAGGATTCTGAATGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067925461 Original CRISPR ACATGCTTATAAAACACGAG AGG (reversed) Intronic
902868550 1:19297530-19297552 ACATGTTTTGAAAACACAAGAGG + Intergenic
915724031 1:158005026-158005048 ACATGCTTACAAAACATCTGGGG + Intronic
916350202 1:163840760-163840782 TCATGCTTCTAAAACACAAATGG + Intergenic
916359048 1:163947097-163947119 ATATCCTGATAAAAGACGAGGGG - Intergenic
917651395 1:177081466-177081488 ACACTCTTATAAAACAAGAGTGG + Intronic
918026476 1:180754309-180754331 ACATGTATATAAAACTAGAGGGG - Intronic
920840349 1:209548629-209548651 ACATGATTATACAACAAGGGAGG - Intergenic
921063370 1:211605526-211605548 ACATGCTTAAAAAAGACAATAGG + Intergenic
924850194 1:247821022-247821044 ACATGCTTATAAACAACTAATGG - Intergenic
1066622911 10:37377189-37377211 AAATGCTAATGAAACACGAGAGG + Intronic
1067925461 10:50504007-50504029 ACATGCTTATAAAACACGAGAGG - Intronic
1069188236 10:65454043-65454065 AAATGCTTAGGAAACATGAGAGG - Intergenic
1071091200 10:81920464-81920486 TCATGCTTATTAAACCTGAGTGG - Intronic
1071164287 10:82786487-82786509 ACATGCTTCCAAAACACAATGGG - Intronic
1073036677 10:100568674-100568696 ACATTTTTAAAAAACACTAGAGG - Intergenic
1074475717 10:113772287-113772309 AGATGCTTATAAAATACCAGGGG + Intronic
1077180351 11:1209531-1209553 ACATGCTTCTCAAACACCAGAGG - Intergenic
1078716418 11:13843602-13843624 CCATCCTTATAAAACAGGAGGGG + Intergenic
1080381671 11:31778060-31778082 ATATGCTTTTAAAACTCGAGTGG + Intronic
1080416443 11:32073706-32073728 ACATGTTTTTAAAGCATGAGTGG + Intronic
1081358997 11:42148990-42149012 ACATGTTTTTCAAACACAAGAGG - Intergenic
1086773119 11:90794243-90794265 ACATACTTGTAAAACCCAAGAGG - Intergenic
1092777677 12:11958657-11958679 AGATGCTTCTAAATCACAAGAGG - Intergenic
1093406241 12:18808377-18808399 AGATTCTTATAAAACATTAGGGG + Intergenic
1094625775 12:32122580-32122602 ACCTGATTATAAAACATGACTGG - Intronic
1094782379 12:33806001-33806023 ACATTCTTATAAAGAACAAGTGG - Intergenic
1095293268 12:40500681-40500703 AGAAGCTTTTAAAACAGGAGGGG + Intronic
1099985017 12:89652067-89652089 ACATGTTTAAAAAAAATGAGTGG - Intronic
1109065205 13:57678706-57678728 ACATGCGTCAAAAACACGTGTGG + Intronic
1110857628 13:80313746-80313768 AAATTCTTATAAAACTTGAGAGG + Intergenic
1112806668 13:103170407-103170429 AAATGCTAATAAAACAAAAGTGG + Intergenic
1112969245 13:105238848-105238870 AGGTGCTTATAAAACACAATTGG - Intergenic
1113295825 13:108957547-108957569 AAATGCTTTGAAAACACGTGGGG + Intronic
1115214210 14:30998454-30998476 ACATGCTCAGAAAAGACCAGAGG + Intronic
1116908991 14:50437148-50437170 ACATGTTCATAAAACATGGGTGG + Intronic
1117447333 14:55816769-55816791 AAATGATTATAAAACAAAAGTGG - Intergenic
1118095260 14:62529879-62529901 ACTTGCTTAAAAAACATGATGGG - Intergenic
1120215386 14:81676520-81676542 ATATCCTTATCAAACATGAGGGG - Intergenic
1121132793 14:91464014-91464036 ACATGCTTTTAAAATACGCATGG - Intronic
1121261139 14:92566960-92566982 ATATGCTTATTTAACACCAGTGG + Intronic
1125816250 15:42587390-42587412 AGATGCTTATATAACAGAAGAGG - Intronic
1127848199 15:62890048-62890070 ACATGTTCAGAAAACACAAGTGG - Intergenic
1131749023 15:95485839-95485861 AGATGCTTATAAAACACTTTAGG + Intergenic
1136004828 16:27321991-27322013 ACATTCTTTTCAAACACAAGAGG - Intronic
1140354663 16:74295362-74295384 ATATGCTTACAAATCACCAGGGG - Intergenic
1144040368 17:11405215-11405237 ACATGCATTTAAATCACCAGGGG + Intronic
1144321239 17:14122314-14122336 TTATGCTTATAAAACACACGAGG + Intronic
1155406328 18:25491829-25491851 ACTTGCTTTTAGAACACAAGAGG - Intergenic
1157563454 18:48664232-48664254 GCATGCTTATGAAACAAGTGTGG - Intronic
1158981354 18:62764987-62765009 ACATGCATTTAAAAGACAAGTGG - Intronic
1159717139 18:71839143-71839165 AAATGAATATAAAAAACGAGAGG + Intergenic
1161105704 19:2443046-2443068 ACCTGCTTATTAAACACGGTGGG + Intronic
1162854950 19:13461032-13461054 AGATGCTCAAAAAACACCAGTGG + Intronic
1163527195 19:17828851-17828873 ATATGATTATAAACCATGAGAGG + Intronic
1164504782 19:28850866-28850888 ACATGGTTATAAAGCAGGAATGG - Intergenic
1168443018 19:56388125-56388147 ACGTGCTTATAAAAAAAGGGGGG + Intronic
929328073 2:40642848-40642870 TCATGCTTATAAACCACTAGGGG + Intergenic
929750247 2:44704266-44704288 AGATGCCTAGAAAACACAAGAGG - Exonic
930716251 2:54596469-54596491 ACACCCTCATAACACACGAGGGG - Intronic
932112782 2:69016336-69016358 AAATGCTTTTAAAAAATGAGGGG + Intronic
933128818 2:78646935-78646957 ACATGCATAGAAAACATTAGGGG - Intergenic
934651335 2:96092766-96092788 ACAGGCTTAGAAGACAGGAGAGG + Intergenic
938796340 2:134720485-134720507 ACATGCTTATAACAAAAGATAGG - Intergenic
940037016 2:149321825-149321847 ACATGTTTACAAAACACAACTGG - Intergenic
941079081 2:161039455-161039477 AAATGCTTATAAATCACCCGTGG + Intergenic
945804795 2:214477443-214477465 ACACTCTTATAAATCAGGAGGGG - Intronic
945889857 2:215418551-215418573 ACATGTTAATAAAACATGAAAGG - Intronic
945926226 2:215807214-215807236 ACAAGATTATAAAAAAAGAGAGG + Intergenic
1170695785 20:18657322-18657344 ACATGCTGAAAAAAAACAAGGGG + Intronic
1171057072 20:21917683-21917705 ACAACTTTATAAAACACGATTGG - Intergenic
1175972247 20:62692404-62692426 ACATGCTTGTGAAACAGAAGTGG + Intergenic
1177161133 21:17549317-17549339 ACAGGTTTATGAAACACGGGAGG - Intronic
1179601984 21:42485389-42485411 GCATTGTTATATAACACGAGAGG - Intronic
1181957681 22:26599939-26599961 ACATGCTTAGCAAACACTTGAGG - Intronic
1182930539 22:34169989-34170011 TCAGGCATATAAAACAGGAGGGG - Intergenic
1183126382 22:35785407-35785429 ACATACTTTTAAAACAGGAGTGG + Intronic
951123532 3:18957518-18957540 ACATGTTTATAAAACAGATGTGG + Intergenic
953091881 3:39736142-39736164 GCATGTTTATAAAACAAGAAGGG + Intergenic
956630163 3:71309050-71309072 GCTTGCTGATAAAACACAAGAGG + Intronic
956964100 3:74438587-74438609 ACATGCCTATAAAAAGCAAGAGG - Intronic
960406569 3:117268024-117268046 CCATGTTTAAAAAACAAGAGTGG - Intergenic
965999896 3:174935790-174935812 AAATGATTATAAAACATGAGAGG - Intronic
974450530 4:62050241-62050263 ACATGGTTATAAATCAAAAGTGG - Intronic
975120567 4:70723870-70723892 AAATGCTTATCAAACACAATGGG - Intronic
975659226 4:76671699-76671721 ACATGTTAATAAAACACGTTAGG + Intronic
975740443 4:77424439-77424461 ACATGCTTCTAAAACACAATGGG + Intronic
975972823 4:80062457-80062479 ACATGCTCATAAAACAGATGTGG + Intronic
978172253 4:105687433-105687455 AGATGCTTATAAAATAATAGTGG - Intronic
980702856 4:136455192-136455214 ACATGCTCCTAAAAAACCAGTGG + Intergenic
982330914 4:154181313-154181335 ACATGCATATTAAACACCAAAGG + Intergenic
984560779 4:181266852-181266874 AAATGCTTATGATACAAGAGAGG - Intergenic
986117570 5:4793673-4793695 ACATGCTTAAAAAACAAGGTGGG + Intergenic
989172946 5:38491625-38491647 AAGTGCCTATAAAACACCAGTGG + Intronic
992909804 5:81384890-81384912 ACCAGCCTATAAAACAAGAGAGG - Intronic
993112779 5:83679308-83679330 CCATGCGTATAAAACATGGGAGG + Intronic
995382299 5:111548593-111548615 ATATGCTAATAAAAAAGGAGGGG + Intergenic
997378788 5:133420689-133420711 AGATGCTTCTAACACAGGAGAGG + Intronic
998723289 5:144978032-144978054 ACATCCTTAGAGAACACTAGTGG - Intergenic
1003315162 6:5004889-5004911 ACATGCTTCTCAAACTAGAGAGG + Intergenic
1007941669 6:45787299-45787321 ACATGCTTATAAGATATGAGAGG + Intergenic
1008730975 6:54482071-54482093 ATATGCTTATAAAAAACTCGAGG - Intergenic
1010636602 6:78266831-78266853 AGATGTTTATAAAACAAGTGAGG + Intergenic
1010669475 6:78670805-78670827 ATATGGTTAAAAGACACGAGTGG + Intergenic
1012455512 6:99399510-99399532 AAATGCTTCTAAAACAGAAGTGG + Exonic
1012617687 6:101297334-101297356 GCATGCCTATAAAACCAGAGTGG + Intergenic
1015654919 6:135507192-135507214 ACATGTTAATAATACAGGAGGGG + Intergenic
1016194230 6:141312862-141312884 ACATGTTAATAAAACTTGAGAGG - Intergenic
1017014533 6:150089311-150089333 ACAGGCTTATAGCACAGGAGAGG - Intergenic
1024407306 7:48996833-48996855 ACATGTTTACAAAACACGCTAGG + Intergenic
1026323660 7:69289122-69289144 ATATGTTTATAAAACAACAGGGG - Intergenic
1028443945 7:90896925-90896947 ACATGCTTTTTAAACACAAATGG - Intronic
1029081494 7:97978029-97978051 AATTGCTTATAAAACAGGACTGG - Intergenic
1029642946 7:101832501-101832523 ACAGGTTTATCAAACACAAGTGG + Intronic
1030563926 7:111127189-111127211 ACATGCTCATACATCATGAGAGG + Intronic
1030599720 7:111580001-111580023 ATAAGCTTATAAAAGAAGAGAGG - Intergenic
1033351303 7:140564440-140564462 ATATGCTTATAAATAATGAGAGG + Intronic
1033924139 7:146436546-146436568 ACATACTTATAAAATACAATAGG + Intronic
1042430763 8:68703782-68703804 ACATGAGTATAAAACATGAAAGG - Intronic
1044481434 8:92693998-92694020 AAATGCCTATAAAACAAAAGTGG + Intergenic
1045067981 8:98469209-98469231 AGATGATTATAATACACGAATGG + Intronic
1047808705 8:128384603-128384625 ACATACTTATAAAAACAGAGGGG + Intergenic
1050989998 9:12138331-12138353 ACTTGCTTCTAAAACAAGAAAGG + Intergenic
1051449619 9:17180751-17180773 ACATTCTTAAAAAATAGGAGGGG - Intronic
1051568876 9:18533125-18533147 ACATGCTTAGAAGAAAAGAGAGG + Intronic
1052338447 9:27342365-27342387 AAACGCTTCTAAAACAAGAGTGG + Intronic
1056003875 9:82246698-82246720 ACATGCTTCTAAATAACCAGGGG - Intergenic
1060421158 9:123470647-123470669 ACATGGTGATAAAACAGAAGAGG + Intronic
1061641766 9:131963765-131963787 CAATGCTTATATAACAAGAGAGG - Intronic
1187637665 X:21249749-21249771 AGATGCTGATAAAATACAAGTGG - Intergenic
1188912693 X:35868974-35868996 TTTTGCTTCTAAAACACGAGAGG - Intergenic
1189019865 X:37323588-37323610 ATATGCTTTTGAAAGACGAGTGG + Intergenic
1191872100 X:65755994-65756016 ACATGCTCATAAAAGACTTGAGG - Intergenic
1191874122 X:65777141-65777163 ACATCCTTATTAAACATCAGTGG + Intergenic
1191952430 X:66607112-66607134 ACATGCTCAGAAAATACTAGTGG + Intronic
1192366795 X:70480474-70480496 ACATGCTTTCAACACACAAGGGG - Intronic
1193252847 X:79312671-79312693 ACATGCTTGTAAATGACCAGTGG + Intergenic
1193369980 X:80684062-80684084 ACATCCTTATAAAATTCCAGAGG + Exonic
1193830638 X:86285428-86285450 ATATGCTTCTAAATCACCAGTGG - Intronic
1195404055 X:104493338-104493360 CCTTGCTTCTAAAACAGGAGAGG + Intergenic
1195524792 X:105874280-105874302 ACAGACTTATAAAACAAAAGTGG + Intronic
1197683677 X:129415494-129415516 ACATACTTATATAACAAGAGAGG + Intergenic
1198199237 X:134398738-134398760 ACTTGCTTAGATAACAGGAGAGG + Intronic
1198810156 X:140527421-140527443 TCATGCTTAATAAACAAGAGGGG - Intergenic
1201278839 Y:12323200-12323222 ACATGTTTACAAAACACAATTGG - Intergenic