ID: 1067925462

View in Genome Browser
Species Human (GRCh38)
Location 10:50504032-50504054
Sequence TACCTGCATCGATATGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067925461_1067925462 2 Left 1067925461 10:50504007-50504029 CCTCTCGTGTTTTATAAGCATGT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1067925462 10:50504032-50504054 TACCTGCATCGATATGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067925462 Original CRISPR TACCTGCATCGATATGAGAG AGG Intronic
No off target data available for this crispr