ID: 1067926580

View in Genome Browser
Species Human (GRCh38)
Location 10:50514564-50514586
Sequence GGTAATATATTCACAGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067926577_1067926580 15 Left 1067926577 10:50514526-50514548 CCTGAGCTTAATCACATCTATAG 0: 1
1: 0
2: 1
3: 28
4: 198
Right 1067926580 10:50514564-50514586 GGTAATATATTCACAGCTACTGG No data
1067926575_1067926580 29 Left 1067926575 10:50514512-50514534 CCCTATCTCAAGATCCTGAGCTT 0: 2
1: 1
2: 30
3: 183
4: 650
Right 1067926580 10:50514564-50514586 GGTAATATATTCACAGCTACTGG No data
1067926576_1067926580 28 Left 1067926576 10:50514513-50514535 CCTATCTCAAGATCCTGAGCTTA 0: 1
1: 11
2: 102
3: 341
4: 969
Right 1067926580 10:50514564-50514586 GGTAATATATTCACAGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067926580 Original CRISPR GGTAATATATTCACAGCTAC TGG Intronic
No off target data available for this crispr