ID: 1067927409

View in Genome Browser
Species Human (GRCh38)
Location 10:50524089-50524111
Sequence ATGCTCACTTTTAAGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067927409_1067927412 28 Left 1067927409 10:50524089-50524111 CCCTAGATCTTAAAAGTGAGCAT 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1067927412 10:50524140-50524162 TTTTGTACCCCTCACTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067927409 Original CRISPR ATGCTCACTTTTAAGATCTA GGG (reversed) Intronic
901739542 1:11333292-11333314 ATGCTCTCGTCTCAGATCTAAGG + Intergenic
902300450 1:15498722-15498744 AAGATCACTTTCAAGATCCATGG - Intronic
903246920 1:22022966-22022988 ATGCTCAGTTTTAAGTACTGGGG + Intergenic
908055632 1:60283745-60283767 TTGTTCAATTTAAAGATCTATGG + Intergenic
910110752 1:83680491-83680513 ATTCTACCTTTTAAAATCTATGG - Intergenic
913718785 1:121569197-121569219 ATGCTTACTATTAGTATCTATGG + Intergenic
915864482 1:159484260-159484282 ATACTCATGTATAAGATCTAGGG + Intergenic
917180325 1:172289214-172289236 AAGCTTACTCTTAAAATCTAGGG + Intronic
917643015 1:177001504-177001526 ATTCTCATTTTTAAGAAATAAGG + Intronic
920126068 1:203694722-203694744 ATGATCTTTTTTAAGATCCAAGG - Intronic
921379426 1:214508928-214508950 AAGCTCACTGTTGAGACCTACGG - Intronic
1063731649 10:8704120-8704142 ATCCTCAGTATTAAGTTCTACGG + Intergenic
1065872793 10:29970329-29970351 ATGCTCAAATTTAAGAGCCATGG + Intergenic
1067927409 10:50524089-50524111 ATGCTCACTTTTAAGATCTAGGG - Intronic
1068220718 10:54042190-54042212 ATTCTCTCTTTTAAGTTTTAGGG + Intronic
1068933322 10:62613128-62613150 ATGTTCACTTTTAAGGTTTGTGG - Intronic
1070917527 10:80164378-80164400 ATGCTCAGTTTTCTGATCCATGG - Intronic
1071009645 10:80923185-80923207 CTCCTCATTTTTAAGATTTAGGG - Intergenic
1073310014 10:102533663-102533685 TTGCTCACTTTGAAGATGGAGGG - Intronic
1073692923 10:105831299-105831321 ATGCTCTCTTTAAACACCTAGGG - Intergenic
1077005104 11:351313-351335 AGGGTCCCTTTTAAGATTTAGGG - Intergenic
1079528202 11:21415896-21415918 ATGCTGAATTTTAAGGACTATGG - Intronic
1081559384 11:44199018-44199040 ATGCTTTCTTTTTAGATTTAGGG + Intronic
1082219754 11:49620189-49620211 ATGCCCACTTTCAACATCTTAGG + Intergenic
1084608901 11:70188319-70188341 CTGCTCACTTTTCACCTCTAGGG - Exonic
1086128955 11:83381015-83381037 ATGCTTACTTTTATGACCTCAGG + Intergenic
1086629878 11:89004596-89004618 ATGCCCACTTTCAACATCTTAGG - Intronic
1087924647 11:103905258-103905280 AAGTTCCCTTTTAAGAACTAAGG - Intergenic
1088156689 11:106813923-106813945 ATCCTCAGTTTTAAGATTTAGGG + Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1091928178 12:4372413-4372435 ATGCTCACGTTTAATAGCTGGGG - Intronic
1092332829 12:7601367-7601389 ATGGTCACTTATATGAACTATGG - Intergenic
1093390569 12:18614618-18614640 ATCTTCACATTTAAGAGCTAAGG - Intronic
1094522273 12:31204915-31204937 AAGTTCACTTTTGAGATCTGGGG - Intergenic
1096951092 12:55472356-55472378 TAGCTCACTTTTAAGATAGAGGG + Intergenic
1098866971 12:75774116-75774138 ATACTCACTTTTAAGCTCAAAGG - Intergenic
1099563725 12:84213087-84213109 ATGCTCACTTTGAATATATTGGG - Intergenic
1099641446 12:85291406-85291428 TTGCTCACTTTTTAAATTTAAGG - Intronic
1100461056 12:94799658-94799680 ATGCTTCCTGTTGAGATCTATGG - Intergenic
1101655685 12:106718022-106718044 ATGTGCACTTTTAAAATCTAAGG - Intronic
1103228210 12:119305980-119306002 ATTCTCTCTTTAAAGACCTAAGG - Intergenic
1106660725 13:31797168-31797190 AAGCACACTTTTAACATCTCAGG - Intronic
1106770413 13:32956057-32956079 TTGCTCACTTTTAAAATGAAAGG - Intergenic
1107627868 13:42308647-42308669 TAGCTCACTTCTAAGATCTGAGG - Intronic
1111235092 13:85399498-85399520 ATGCTAACTTTAAATATCAATGG - Intergenic
1111279922 13:86008845-86008867 ATGCTAACTTTTAAAGTCTGTGG + Intergenic
1112239210 13:97664377-97664399 ATGCTCCCCCTTAAGATGTAAGG + Intergenic
1113262646 13:108582419-108582441 ATCCTCTCTTTAAAGATCTCAGG - Intergenic
1115056987 14:29140550-29140572 AAGATCACTTTTACTATCTATGG + Intergenic
1115377199 14:32690354-32690376 ATGCTCACTTTAAATACCAAAGG + Intronic
1115911131 14:38256893-38256915 AACCTAACTGTTAAGATCTATGG - Intergenic
1116484958 14:45436562-45436584 ATTCTCACCTTTTAGATCTCAGG + Intergenic
1117879091 14:60291232-60291254 AGCCTCACTTTTAAGATATTTGG - Intronic
1118000252 14:61516416-61516438 CTGTTTACTTTTAAGATCTTAGG + Intronic
1118775650 14:68972319-68972341 ATGCCCACTTTTTAGAGCTGGGG - Intronic
1119530573 14:75357502-75357524 ATGATAAATTTTAAGAACTAAGG - Intergenic
1120285514 14:82495568-82495590 ATGCTCCATTTCAAGATTTAGGG - Intergenic
1124194074 15:27605344-27605366 ATGCACAGGTTTAAGTTCTAAGG - Intergenic
1125060842 15:35421372-35421394 AGATTCACTTTTAAGATCAATGG + Intronic
1126786061 15:52178912-52178934 CTGCTCACTTTTGAGCTCTGAGG - Intronic
1128449224 15:67792759-67792781 TTGATTACTTTTAAGATTTATGG - Intronic
1130116050 15:81004964-81004986 ATGCTTTCTTTTCAGATCTGTGG - Exonic
1130826147 15:87548180-87548202 ATCCCTACTGTTAAGATCTAAGG - Intergenic
1131888829 15:96950290-96950312 ATGCTCACTTATATGATTGAGGG - Intergenic
1146306289 17:31732308-31732330 ATGCTCGCTGCAAAGATCTACGG + Intergenic
1153365228 18:4248232-4248254 ATGCTGACTTTAAAGCTCAAAGG + Intronic
1153421165 18:4906924-4906946 ATGCTCAGACTTAAGACCTACGG - Intergenic
1156027854 18:32676618-32676640 ATCCCCACTTTTAAAATCTTTGG - Intronic
1156655898 18:39285532-39285554 ATTCTCACCTTCAAGATCTGTGG - Intergenic
1158465306 18:57684987-57685009 ATGCTTCCTTTGAAGGTCTAGGG - Intronic
1159538828 18:69749291-69749313 ATGTTCATTTTTAAGTTCTGGGG - Intronic
1166480000 19:43163429-43163451 ATCCTAATTTTTAAGATGTAAGG + Intronic
925559483 2:5174532-5174554 ATCCTCATTTTAAAGATTTAGGG + Intergenic
928443992 2:31316957-31316979 ATGTTTCCTATTAAGATCTAAGG + Intergenic
928986862 2:37190684-37190706 ATGGTCAATTTTAAAATTTAAGG - Intronic
929226709 2:39518316-39518338 AGAGTCACTTTTATGATCTATGG + Intergenic
930435576 2:51337335-51337357 AAGCTCAAATTTAAGATGTATGG + Intergenic
930449188 2:51512915-51512937 ATTTTTACTTTTAAGATCAAAGG + Intergenic
930882971 2:56292893-56292915 CTGCTCTATTTTAAAATCTAAGG - Intronic
933435699 2:82246842-82246864 ATGCTGACTCTTAAGTTCCAGGG + Intergenic
933538487 2:83608430-83608452 ATTCTCACTTATAAGAACAATGG + Intergenic
935197452 2:100826141-100826163 ATGTACACTTTTAAAAACTAAGG + Intronic
935220402 2:101007411-101007433 AAGTTCACTTTCAAGATCTAAGG - Intronic
937523720 2:122741875-122741897 AGGCTCACTCTGAATATCTAGGG + Intergenic
938818963 2:134934416-134934438 ATGCTCACCTTTAAAAGCTTTGG + Intronic
940335951 2:152527728-152527750 ATGATCACTTCTTTGATCTATGG + Intronic
940454375 2:153877208-153877230 ATGCTCATTGTTAAGATAGATGG + Intronic
940490957 2:154359951-154359973 ATGCTTATTTTTGAGATCAAAGG - Intronic
942482965 2:176408782-176408804 ATGCTAATTTTTAAAATGTAAGG + Intergenic
943410913 2:187546635-187546657 ATTCTCATTTTTAATATGTATGG - Intronic
943498594 2:188656455-188656477 TTGTTCACTTTGAAGATCTAAGG - Intergenic
947283964 2:228489350-228489372 CTGCTCACTTTTAACATAAAGGG + Intergenic
948168428 2:235880783-235880805 ATGCTAAGTTTTAAAATCCACGG + Intronic
1169634078 20:7667282-7667304 ATGCTCCATTCTAAGTTCTAGGG - Intergenic
1172535551 20:35670289-35670311 ATGCTCAGGTCTAAGATCCAAGG - Intronic
1177508945 21:22057626-22057648 ATTTTCATTTTTAAGATGTAGGG + Intergenic
1178088371 21:29135766-29135788 ATGCCCACTTTCAAAATCCATGG + Intronic
1178435942 21:32558576-32558598 AGGGTCCCTTTTAAGATTTAAGG - Intergenic
1179088615 21:38242808-38242830 ATGCTCACTTATAAGCTTAAGGG + Intronic
1184825101 22:46945093-46945115 ACTCTGACTTTTAAGAACTAAGG - Intronic
950374443 3:12558905-12558927 AGGCTCAGTTTTACGATCTGTGG - Intronic
950658844 3:14454061-14454083 AGACTCACTTTTAAGAGCGAGGG - Intronic
950767411 3:15283523-15283545 ATGCAATCTTTTAAGATGTACGG + Intronic
951208625 3:19949677-19949699 ATGCTAATTTTTAATCTCTAAGG - Intronic
951703329 3:25518882-25518904 ATGCTTCCTTCTAAGATCTTAGG - Intronic
954206543 3:49063396-49063418 ATGGTCAAATTTAAGAACTAGGG + Intronic
956318259 3:67964781-67964803 ATGCTCCCTCTGAATATCTAGGG + Intergenic
956934159 3:74080979-74081001 ATGCTCAGTTTGATGATCTTTGG + Intergenic
957219975 3:77369609-77369631 ATGCTCACTTGTGAGAAATAAGG + Intronic
958510472 3:95040309-95040331 ATGTCTACTTTTAAGAGCTAGGG + Intergenic
958711189 3:97718921-97718943 TTGCTCACTTATAAAATCAAGGG + Intronic
963021794 3:140878909-140878931 ATGCTCACTGTGAAGGTCTGTGG + Intergenic
965598334 3:170430099-170430121 ATGCCCACTTTTGAGGTTTAGGG + Intronic
967502467 3:190215402-190215424 ATTCTCAATTATAAGATTTAAGG + Intergenic
971901650 4:32667251-32667273 ATGCTCATTTTTAAAATAGAAGG + Intergenic
975035952 4:69681650-69681672 ATGCTCACTTTTATGTTTTTCGG - Intergenic
975362594 4:73488444-73488466 ATGATCACTTTGAAAATCTTAGG - Intronic
975906384 4:79217859-79217881 CTTCTCTCTTTTAAGATTTAGGG - Intergenic
975969204 4:80013755-80013777 AGTCTCACTTTTCATATCTATGG + Intronic
979493451 4:121357308-121357330 ATGCTCTCTCTTAGGATCTCAGG - Intronic
980748449 4:137054749-137054771 ATGCTCTTTTCTAAGAGCTAAGG - Intergenic
982507971 4:156243588-156243610 GTTCTCACTTTTAAGATGGAAGG + Intergenic
983003108 4:162444962-162444984 ATTCTCAATTTTACTATCTATGG + Intergenic
984088947 4:175346494-175346516 ATGGTCACTTTAAAGATCAAAGG - Intergenic
984478076 4:180262594-180262616 ATACTCTCTGTTAAGGTCTACGG + Intergenic
991953974 5:71973688-71973710 ATGCTTAATTTTAAGATAGAAGG + Intergenic
992823508 5:80522963-80522985 AAGCTGACTTTTCAGATCTTTGG + Intronic
992923557 5:81554945-81554967 ATGCTCACTATAAAGTTCAATGG - Intronic
993925930 5:93866321-93866343 ATAATCAATTTTAAGAACTAAGG - Intronic
994537777 5:101053552-101053574 ATAGTCACTTTTGAGAACTAAGG - Intergenic
995016737 5:107318402-107318424 ATGCTCACTTTGAAGCTTTTAGG - Intergenic
995315706 5:110769990-110770012 ATACTCACTTTCAAAATGTAAGG + Intergenic
996186577 5:120484197-120484219 ATACTCACTTTTAAAATGTGAGG + Intronic
996691185 5:126341971-126341993 ATGCTCATTTTTGACATCTCTGG - Intergenic
997762211 5:136460573-136460595 ATGATCACTTTCAAGAACTTTGG - Intergenic
1001280809 5:170385167-170385189 ATGCTCATTCTTAGGTTCTAGGG - Intronic
1001932799 5:175685074-175685096 CTGCAAGCTTTTAAGATCTATGG - Intronic
1003467528 6:6395322-6395344 ATCCTCACTTTTCAGATTTTTGG - Intergenic
1004983184 6:21049550-21049572 ATGCTTACTTTTAATTTTTAAGG + Intronic
1011648183 6:89480444-89480466 ATACTCACTTTTGAGATGAAGGG - Intronic
1012741625 6:103022951-103022973 TTGGCCACTTTTAAGATCTGTGG + Intergenic
1014657163 6:124121631-124121653 TTGCTCACTATTCAGATGTAGGG + Intronic
1017498069 6:154998911-154998933 AGGCTTAATTTTAAGATCTCAGG + Intronic
1017765916 6:157607023-157607045 ATGCTAACTAGTAAGATCTATGG - Intronic
1020818995 7:12942294-12942316 ATGCTCACTTTTAAAAGAGAGGG - Intergenic
1020890372 7:13870668-13870690 CAGATCAGTTTTAAGATCTATGG + Intergenic
1023629239 7:42147164-42147186 ATGCTCACTCCTCAGATCAAAGG - Intronic
1024803330 7:53106940-53106962 ATGCTCACTTCTAATAACTTTGG - Intergenic
1024932297 7:54676455-54676477 AAGCCCACTATTGAGATCTACGG + Intergenic
1026136128 7:67662586-67662608 GTGGACACTCTTAAGATCTATGG - Intergenic
1026639289 7:72110177-72110199 ATGCTTACCTGTAAGGTCTAGGG - Intronic
1028259475 7:88643854-88643876 ATAATCACTTATAAGTTCTAAGG - Intergenic
1029783911 7:102766288-102766310 AGGCTCTATTTTAAGTTCTATGG + Intronic
1031103034 7:117505907-117505929 ATTCACACTTCTAAGATCAAGGG + Intronic
1031244490 7:119291446-119291468 TTGCTTAATTTTAAGATCTCAGG - Intergenic
1031611236 7:123830092-123830114 ATGGTCACTTGTAATATTTAGGG - Intronic
1032307438 7:130749601-130749623 ATGCTCACTATTAACAGTTAGGG + Intergenic
1033964912 7:146962974-146962996 ATGCTCACTTTTTACATTTTAGG - Intronic
1036484193 8:9164789-9164811 ATACTCTATTTTGAGATCTAGGG - Intronic
1038111182 8:24500242-24500264 ATGCTCACTGGTAACATGTAAGG - Exonic
1038718753 8:30014491-30014513 ATGCTGCTTTTGAAGATCTAGGG - Intergenic
1039284238 8:36022989-36023011 TTGCTCCCTTTTGAGTTCTATGG + Intergenic
1041828898 8:62130241-62130263 TTGCTTACTCTTAAGATCTGGGG - Intergenic
1042814003 8:72858087-72858109 ATGCTCAGTTTTAACATTTAAGG - Intronic
1043270607 8:78329001-78329023 ATGCTCACTGTGAAGGTCTGCGG - Intergenic
1044141995 8:88667687-88667709 ATGTTAAATTTTAATATCTAGGG + Intergenic
1046259755 8:111752059-111752081 ATGCTGACTTTGAAGATGGAGGG - Intergenic
1051407952 9:16759375-16759397 ATGGTAACTTTTAAGATTTCAGG + Intronic
1052319760 9:27155320-27155342 TTGGTAACTTTTAAGATCTCAGG - Intronic
1054978934 9:71181208-71181230 ATGTTCACTTTTAAATTGTATGG + Intronic
1055900290 9:81226542-81226564 ATGCTCACTATAAAGATAAATGG - Intergenic
1056134175 9:83614915-83614937 ATACTCACCTATAAGGTCTAAGG + Intergenic
1056312043 9:85350718-85350740 ATGCTCACTGTCTAGTTCTATGG + Intergenic
1057247955 9:93473821-93473843 ATACTCACTTTTAACATCAGAGG - Intronic
1058502748 9:105637875-105637897 ATGCTCAATTTTAGGAACTATGG - Exonic
1186849151 X:13562964-13562986 AAGCTCACTATTGAGACCTATGG - Intergenic
1187276233 X:17818586-17818608 ATACTCAATTTCAAGATATACGG + Intronic
1188325157 X:28793018-28793040 ATGAAGACTTTTAATATCTATGG + Intronic
1189101150 X:38191485-38191507 ATGCTCACTTTTACTATGTATGG - Intronic
1192353104 X:70372966-70372988 ATACTCACAGTTAAGATTTATGG + Intronic
1193225799 X:78982615-78982637 TTTTTCTCTTTTAAGATCTAGGG - Intergenic
1193272302 X:79543923-79543945 CTGATCACTTTAGAGATCTAGGG + Intergenic
1193540157 X:82761436-82761458 CAGCTCAGTTTTAAGATCTCAGG + Intergenic
1194711201 X:97238501-97238523 ATGCACATTTTTAAGTTTTATGG + Intronic
1197007824 X:121524033-121524055 ATGCTTACTTTAAAAAGCTATGG + Intergenic