ID: 1067928134

View in Genome Browser
Species Human (GRCh38)
Location 10:50531715-50531737
Sequence CAGTGGGCAGGTAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 0, 2: 5, 3: 87, 4: 803}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067928134_1067928142 -2 Left 1067928134 10:50531715-50531737 CCACCTTCCCTACCTGCCCACTG 0: 1
1: 0
2: 5
3: 87
4: 803
Right 1067928142 10:50531736-50531758 TGCCTGAATGTGTGCTTGGAAGG No data
1067928134_1067928141 -6 Left 1067928134 10:50531715-50531737 CCACCTTCCCTACCTGCCCACTG 0: 1
1: 0
2: 5
3: 87
4: 803
Right 1067928141 10:50531732-50531754 CCACTGCCTGAATGTGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067928134 Original CRISPR CAGTGGGCAGGTAGGGAAGG TGG (reversed) Intronic
900662056 1:3789680-3789702 CAGGGGACAGGAAGGGAAGCGGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901132927 1:6973870-6973892 CTGTGGGAAGGTGGGGCAGGAGG - Intronic
901459281 1:9382119-9382141 CAGGGGGCAGGTTAGGATGGAGG + Intergenic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901741492 1:11345004-11345026 TGGTGGGCAGGTTGGGGAGGTGG + Intergenic
901859340 1:12064096-12064118 CAGTGGCCAGCTTAGGAAGGGGG - Intronic
901947471 1:12715455-12715477 CAGTGGGGGGGTGAGGAAGGTGG + Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902542948 1:17167214-17167236 CTGTGGCCAGGAAGGGAGGGAGG - Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
903012889 1:20343462-20343484 CCGGGGGCGGGTGGGGAAGGGGG - Intronic
903174975 1:21575379-21575401 CCTTTGGGAGGTAGGGAAGGGGG - Intronic
903332479 1:22603086-22603108 CCGTTGGCAGGCAGGGAAGCAGG + Exonic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904812945 1:33175589-33175611 CAGTTGGCGTGTTGGGAAGGAGG + Intronic
905051201 1:35052640-35052662 CAGTAGGCAGGTAGGCAGGAAGG - Intergenic
905122949 1:35695727-35695749 CAGTGGGGAGGGAAGAAAGGAGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905876379 1:41434390-41434412 CAGTGGGCAGTCAAGGAAGGAGG - Intergenic
905930569 1:41784023-41784045 CAGGGAGTAGGTAGGGAAGAAGG + Intronic
905979101 1:42207189-42207211 CAGAGGCCAGGAAGGGTAGGGGG - Intronic
906085895 1:43134521-43134543 AAGTGGGCAGGAGGGGAAAGGGG - Intergenic
906493943 1:46289961-46289983 CAGTGGGCTGGTAGGGGAAGAGG + Intronic
906501294 1:46343138-46343160 CAGTGGGCAGGGATGGGGGGTGG - Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
906740463 1:48177874-48177896 AGGGGGGCAGGTAGGGAAGAGGG + Intergenic
906822160 1:48940982-48941004 GAGTGGGCAGGCAGAGAAAGGGG + Intronic
907017241 1:51028903-51028925 GAGGGGGCAGGGAGGGAGGGAGG - Intergenic
907299234 1:53476216-53476238 CAGAGGGCAGGCAGAGAAGGAGG - Intergenic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907501649 1:54885848-54885870 CAGGGTGCAGGTGGGGAGGGAGG + Intronic
907580775 1:55570625-55570647 CAGTGAGCTGGAAGGGAAAGAGG + Intergenic
907974517 1:59418469-59418491 GAGTGAGCAGGAAGGGAAGGAGG + Intronic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
910649294 1:89547798-89547820 TAGTGGGCGGGGAGGGGAGGGGG + Intronic
911086512 1:93982232-93982254 GAGGGGGCAGGGAGGGAAGGGGG - Intergenic
911190092 1:94939849-94939871 CATTGAGTAGGTTGGGAAGGTGG - Intergenic
912231641 1:107799849-107799871 CAGAGTCCAGGAAGGGAAGGAGG - Intronic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
914859198 1:151372471-151372493 CAGTGGGGTGGTGGGGGAGGGGG + Intronic
914937418 1:151993409-151993431 GAGTGGGAAAGTAGGAAAGGTGG + Intronic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915216726 1:154345344-154345366 CAGTGGGCAGGAAGGGATCCAGG + Exonic
915461713 1:156074657-156074679 CGGGGGGCAGGTGGGGAGGGGGG - Exonic
915629683 1:157142622-157142644 CAGTGGGAAGGCAGGGGTGGGGG - Intergenic
916554987 1:165886771-165886793 AAGAAGGCAGGGAGGGAAGGAGG - Intronic
917435698 1:175018936-175018958 CATTGGGCAGGTGAGGAATGAGG - Intronic
917816285 1:178713199-178713221 GAGGGGGGAGGAAGGGAAGGAGG + Intergenic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919801968 1:201359558-201359580 TAGCTGGAAGGTAGGGAAGGAGG + Intronic
919843162 1:201623617-201623639 GAGCAGGCAGGGAGGGAAGGGGG + Intronic
920092769 1:203465931-203465953 CAGTAGACAGGTAGGGAACATGG + Intergenic
920189200 1:204181715-204181737 GGGTGGGCAGGCAGGGAGGGAGG - Intergenic
920500050 1:206480180-206480202 GAGTGGGCAGGAAGGGGAGATGG + Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921978207 1:221226249-221226271 CAGAGGGAAGGTAGAGAAGGTGG - Intergenic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
922606680 1:226894044-226894066 CAGTGTGCTGGTGGGCAAGGCGG + Exonic
922915751 1:229256227-229256249 AGGTGGGCAGGAAGGGGAGGTGG + Intergenic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
924181276 1:241440635-241440657 CGGTGGGGAGGGAGGGAGGGAGG + Intergenic
924424668 1:243940385-243940407 GACTGGGAAGGGAGGGAAGGAGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924716094 1:246575600-246575622 TAGTGGGTATGTAGGGCAGGGGG + Intronic
1062950128 10:1492773-1492795 AGGGGAGCAGGTAGGGAAGGAGG + Intronic
1063289943 10:4735037-4735059 AAGGAGGCAGGGAGGGAAGGAGG - Intergenic
1064291956 10:14043430-14043452 CAGTGGGCAGGGAGTGAAATTGG - Intronic
1064405512 10:15059020-15059042 GAGAGGGAAGGAAGGGAAGGAGG - Intronic
1064717145 10:18188283-18188305 AGGTGGGCAGGAAGGAAAGGAGG - Intronic
1064890933 10:20172402-20172424 CAGTGGGCCGGTGAGGCAGGTGG - Intronic
1066203060 10:33160349-33160371 CAGTGAGAATGTAGGGAATGTGG - Intergenic
1066306088 10:34142582-34142604 CGGGGGGCAGGGAGGGAGGGAGG + Intronic
1066381542 10:34906167-34906189 CCGAGGGAAGGCAGGGAAGGCGG - Intergenic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067563974 10:47323412-47323434 AAGGGGACAGGAAGGGAAGGGGG - Intronic
1067567060 10:47347043-47347065 CAGTAGGCAGCTGGAGAAGGTGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068021136 10:51585974-51585996 GAGTGGGGAGGTAGGGCAAGAGG + Intronic
1069371856 10:67756148-67756170 CAGAGGCCAGGTAGGGTGGGGGG + Intergenic
1069679987 10:70277590-70277612 AAGTGGCCATGTACGGAAGGGGG - Intronic
1070514101 10:77187651-77187673 CAGGGGGCAGGCAGAGAAGCAGG + Intronic
1070674366 10:78402140-78402162 CAGGGGACAGGAAGGGATGGTGG + Intergenic
1070827041 10:79397342-79397364 CAGTGGGCAGCTAGGGCCCGGGG + Intronic
1070889056 10:79928540-79928562 CAGTGGTCAGGTAGGGACTCGGG - Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071373610 10:84979506-84979528 CAGGGGGAAGGTTGGGAGGGGGG - Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071550180 10:86560651-86560673 CAGTGGGGAGCTGGGGAGGGTGG - Intergenic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1072066873 10:91879913-91879935 CAGTGGGCAGGGGGGGCATGGGG - Intergenic
1072246391 10:93547642-93547664 GAGTGGGCAGGTAGATAAGTGGG + Intergenic
1072296545 10:94013995-94014017 CGGTGGGCAGGCAGGGGATGAGG + Intronic
1073072470 10:100803378-100803400 GAGAGGGCAGGAAGGGAATGAGG - Intronic
1073426571 10:103458808-103458830 CAGTGGGCAGGGTGGGCAGCAGG - Exonic
1073819844 10:107249303-107249325 GTGGGGGCAGGTAGGGATGGCGG - Intergenic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1075351971 10:121732281-121732303 CAATGGGCAGGCAAGGAGGGTGG - Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075642431 10:124074400-124074422 CAGGTGGCAGGTAGGGGCGGGGG + Intronic
1076059152 10:127400060-127400082 CAGTGTCCAGGGAGGGTAGGAGG - Intronic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076466645 10:130687373-130687395 GAGGAGGCAGGTAGGGAAGGAGG + Intergenic
1076474520 10:130743083-130743105 AGGCGGGCAGGTGGGGAAGGAGG - Intergenic
1076474540 10:130743143-130743165 AGGCGGGCAGGTGGGGAAGGAGG - Intergenic
1076474548 10:130743163-130743185 GGGCGGGCAGGTGGGGAAGGAGG - Intergenic
1076539766 10:131206592-131206614 CAGTGGGCAGCATGTGAAGGAGG + Intronic
1076731991 10:132443902-132443924 GAGAGGGAAGGAAGGGAAGGGGG - Intergenic
1076840686 10:133043781-133043803 CAGTGGGTGGGTTGGGGAGGTGG + Intergenic
1077015948 11:399303-399325 GAGGGGGCAGGTGGAGAAGGGGG - Intronic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077248373 11:1549905-1549927 CTGGGGGCAGGTGGGGCAGGAGG - Intergenic
1077259761 11:1610081-1610103 CGATGGGCAGGAAGGGAAGGCGG - Intergenic
1077490501 11:2858796-2858818 CAGTGAGCAGATGGAGAAGGTGG + Intergenic
1077601268 11:3576588-3576610 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
1077918703 11:6627144-6627166 CAGAGGACTGGTGGGGAAGGTGG + Exonic
1078105754 11:8357063-8357085 AAGAGGGCAGGCCGGGAAGGAGG - Intergenic
1078391175 11:10936810-10936832 TGGTGGGCAGGTTGGGAAAGGGG + Intergenic
1078605981 11:12776007-12776029 CAGTGGGCAGGGAGGGGTGCAGG + Intronic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1079104117 11:17559521-17559543 CAGTGCACAGCTTGGGAAGGAGG - Exonic
1079248771 11:18772433-18772455 CAGTGGACAGCTGGGCAAGGAGG - Intronic
1079822527 11:25148423-25148445 TAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1080780887 11:35429095-35429117 CAGTGGTCAGGAAGGAAAGCTGG - Intergenic
1081538955 11:44016319-44016341 CAGTGGGCAGGCCTGGGAGGTGG + Intergenic
1081666072 11:44917920-44917942 CAGAGGGCAGGCAGGGGATGGGG - Intronic
1081856508 11:46307685-46307707 CAGGGGGCAGGCAGGAAAGAGGG - Intronic
1083034958 11:59628514-59628536 CAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1083299175 11:61731266-61731288 CTGTAGGCAGGAAGGGCAGGAGG + Intronic
1083594857 11:63914340-63914362 CAGGGGCCAGGGAGGGAATGAGG + Intronic
1083735186 11:64676122-64676144 CAGCGGGCAGAGAGGGCAGGGGG + Intronic
1084257185 11:67951162-67951184 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
1084389508 11:68865869-68865891 CAGAGGGAAGGTAGGAAAGGAGG - Intergenic
1084416725 11:69036753-69036775 GAATGGGCATGAAGGGAAGGGGG + Intergenic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085274796 11:75291606-75291628 CTGTTGGCAGCTAGGGAAGGGGG - Intronic
1085332304 11:75663755-75663777 AAATGGGCAGTTAGGGAATGGGG + Intronic
1085479098 11:76806962-76806984 GAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1085829884 11:79888198-79888220 CAGTGACCAGGTAGGGAAGATGG + Intergenic
1086310805 11:85534487-85534509 AAGTGGGGAGGTAGGGAGTGGGG - Intronic
1086597868 11:88595402-88595424 TAGAGGGTAGGAAGGGAAGGAGG - Intronic
1088872792 11:113906313-113906335 CAGTGTGCTGGTATAGAAGGAGG + Intronic
1089340606 11:117754832-117754854 AGGTAGGCAGGTAGGGAGGGAGG - Intronic
1089559438 11:119336427-119336449 GGGTGGGCAGGCAGGGAAGGAGG - Exonic
1090206574 11:124887579-124887601 TAGTGGACAGGTAGCTAAGGGGG - Intronic
1090357069 11:126147232-126147254 CAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1090547687 11:127783165-127783187 CAGTGGGGAGGGTGGGGAGGGGG + Intergenic
1090576056 11:128105232-128105254 GAGTAGGCAGGAGGGGAAGGAGG - Intergenic
1090963742 11:131580411-131580433 CAGAGGGCAGGTGTGGCAGGTGG - Intronic
1091167448 11:133492172-133492194 GAGTGGACAGGAAGGGAAGAGGG + Intronic
1091207027 11:133828756-133828778 GAGTGGGGAGGCAGGGAAGAAGG + Intergenic
1091357314 11:134947267-134947289 CAGTGGACAGAGTGGGAAGGTGG - Intergenic
1091490644 12:929743-929765 AGGTGAGCAGGTAGGGAAGTAGG - Intronic
1091587016 12:1822282-1822304 CAGTGGGCAGTGTAGGAAGGAGG + Intronic
1091637266 12:2206586-2206608 CAGTGAGTAGGTAGGGAGGTGGG - Intronic
1092216743 12:6689012-6689034 CCTTGGGCAGGCGGGGAAGGGGG - Intronic
1092223011 12:6728142-6728164 AAGTGGGAGGGAAGGGAAGGAGG + Intronic
1092427417 12:8385948-8385970 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1094454476 12:30617002-30617024 CACTGGGCAAGCAGGGGAGGGGG - Intergenic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096414904 12:51404559-51404581 CAGTGGTCATGTGGGGATGGAGG - Intronic
1096478518 12:51923179-51923201 CAATGGCCAGGGAGTGAAGGAGG + Intronic
1097182172 12:57177770-57177792 GAGGGGGCAGGTAGAGGAGGCGG + Intronic
1097323694 12:58252511-58252533 AAATAGGCAGGGAGGGAAGGAGG - Intergenic
1097940056 12:65294263-65294285 CAGAGGGCAGGTAGGCCATGAGG - Intronic
1098275069 12:68804807-68804829 CAGTGGGAAGGAGGAGAAGGGGG + Intergenic
1099182274 12:79482524-79482546 AGGTGGGGAGGAAGGGAAGGTGG + Intergenic
1099383884 12:81990180-81990202 AAGTGGGCTGGAGGGGAAGGAGG + Intergenic
1099685683 12:85885547-85885569 CAGAGGCCAGGAAGGGTAGGGGG - Intergenic
1101100282 12:101384689-101384711 CTGGGGGCAGGAAGGAAAGGAGG + Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102266094 12:111486675-111486697 CAGATGGCAGGTATGGAAGAAGG + Intronic
1102670935 12:114618212-114618234 AAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102935502 12:116893140-116893162 AAGTGGGCTGGAAGGGAAAGAGG - Intergenic
1103741858 12:123096510-123096532 CAGTGGGAAGATGGGGAGGGGGG + Intronic
1103848950 12:123918604-123918626 CAGAGGGCAGGAGGGGCAGGGGG - Intronic
1103908810 12:124340650-124340672 CGGTGGGGAGGTAGGCAAGGCGG + Exonic
1103919619 12:124392698-124392720 CAGTGGACATGTAGTGGAGGAGG + Intronic
1104348992 12:128028661-128028683 CTGTGGGCAGGGCGGGAATGTGG + Intergenic
1104466373 12:128994073-128994095 AAGGGGGCAGGAAGGGAAGATGG - Intergenic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1105255104 13:18739227-18739249 CAATGGGCAGGTGGGGGTGGTGG - Intergenic
1105370128 13:19794919-19794941 CAGTGGGGAGGTAGGCAAGTGGG + Intergenic
1105765169 13:23552147-23552169 GAGTGGGTAGGAGGGGAAGGAGG + Intergenic
1105966439 13:25388817-25388839 CAATGGGCAGGAGGGGAAGTTGG + Intronic
1106067908 13:26375380-26375402 CAGTGAGCAGGCAGTGAAGCTGG - Intronic
1106753211 13:32796090-32796112 CAGAGGCCAGGCAGGGAAGGAGG - Intergenic
1107054424 13:36087847-36087869 CAAGGGGAAGGCAGGGAAGGTGG + Intronic
1107295093 13:38899567-38899589 CAGACGGCAGGTAGGAAAAGAGG + Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1107986774 13:45782921-45782943 CAGTCGGCAGGTTGGGGAAGGGG - Exonic
1110121633 13:71888806-71888828 CAGTTGGCAGAGAGGGAATGTGG + Intergenic
1110806886 13:79765218-79765240 CTGTGAGCAGGTTGGCAAGGTGG - Intergenic
1112281541 13:98066908-98066930 CAACGGGAAGGTAGTGAAGGAGG - Intergenic
1112346658 13:98595821-98595843 CAGTGGTCAGGCAGGAATGGTGG + Intergenic
1112759118 13:102673030-102673052 AAGTGGGCAGGGAGGCAATGTGG - Intronic
1112934992 13:104786007-104786029 CAGTGGGCAATTTGGGAATGGGG + Intergenic
1113295966 13:108959032-108959054 CAGTGAGTAGGTGGGGAGGGTGG + Intronic
1113952088 13:114077655-114077677 CGTTGGGCAGGGAGGGAGGGAGG - Intronic
1114612891 14:24053811-24053833 CACTGGGCATGTGGGGAGGGAGG + Intronic
1115434061 14:33353806-33353828 CAGTGGGCAAGAAGGGACAGAGG + Intronic
1115854904 14:37621075-37621097 CAGTGTGTAGGAAGGGAATGGGG - Intronic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1117939242 14:60943571-60943593 CAGTGGGCAGTGAGGGAGTGGGG + Intronic
1118249813 14:64148596-64148618 CAGTGGGCACGTGGTGAGGGAGG - Intronic
1118564496 14:67124434-67124456 CAGTGTACAGGAAGGAAAGGGGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119031639 14:71197325-71197347 CAGTGGGGAGGTAGGGGAGCTGG - Intergenic
1119153650 14:72388636-72388658 GAGTGGCCAGGTAGGGAATGAGG - Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119386375 14:74260228-74260250 CAGAGGGCAGGTGGGGAAGTTGG - Intronic
1119406879 14:74404595-74404617 CAGTTGGGGAGTAGGGAAGGAGG + Intergenic
1119425300 14:74531155-74531177 CAGGCGGCAGGGAGGGAAGGAGG + Intronic
1119485536 14:74984534-74984556 TAGAGGGCAGGCAGAGAAGGAGG - Intergenic
1121798742 14:96756073-96756095 GGGTGGGCAAGAAGGGAAGGCGG + Intergenic
1122327877 14:100893376-100893398 GGGTGGGCAGGCAGGGGAGGTGG - Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1124216636 15:27812938-27812960 TAGTGGGCATGTGGGGAAGTGGG - Intronic
1124234080 15:27971578-27971600 CACTGGACAGGTAGGTAGGGAGG - Intronic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1124398078 15:29322771-29322793 AAGTGGGCAGGAAGGGAAGGAGG - Intronic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1125582114 15:40793520-40793542 CAGTGGTCAGGGTAGGAAGGCGG - Intronic
1126069626 15:44854555-44854577 GAGTGGGCTGGTAGGGCAGCGGG - Intergenic
1126088905 15:45034608-45034630 GAGTGGGCTGGTAGGGCAGCGGG + Intronic
1127063247 15:55209295-55209317 CAGAGGCCAGGAAGGGTAGGAGG - Intronic
1127541023 15:59939071-59939093 CAGGGAGCTGGCAGGGAAGGAGG + Intergenic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127812962 15:62580415-62580437 CAATGGGAAGGAAGGGAGGGAGG - Intronic
1127903759 15:63360859-63360881 CAATGGGCTGGTAGGTGAGGGGG - Intronic
1128218108 15:65948131-65948153 CCCTGGGCAGGGAGGGATGGTGG - Intronic
1128254083 15:66184564-66184586 GGGTGGGCAGGTAGCGATGGCGG - Intronic
1128262947 15:66245203-66245225 CAGTGAACAGGTAGGGACTGGGG + Intronic
1129055118 15:72813849-72813871 CTCTGGGGAGCTAGGGAAGGAGG - Intergenic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129384091 15:75185978-75186000 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129535944 15:76313814-76313836 GGGTGGGGAGGTAGGGAAGGAGG - Intergenic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129906484 15:79191169-79191191 CACTGGCCAGGTAGGGAGGACGG + Intergenic
1130377652 15:83343942-83343964 AAGAGGGGAGGTAGGGAAGTGGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130661974 15:85837916-85837938 CAGTGGGGAGGTGGGGAAGGTGG - Intergenic
1131016397 15:89061082-89061104 AAATGGGGAGGGAGGGAAGGAGG + Intergenic
1131345960 15:91648213-91648235 CAGTTGGCATCTATGGAAGGTGG + Intergenic
1132270631 15:100520772-100520794 GAGTGGGCAGGGTGGGGAGGAGG + Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132726990 16:1343159-1343181 GATTGGGCGGGAAGGGAAGGGGG + Intronic
1132753587 16:1470912-1470934 CAGGGGGCAGTGAGGGGAGGTGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133286849 16:4694510-4694532 CGGTGGGGAGGAAGGGATGGGGG + Intronic
1133370829 16:5244430-5244452 ATGTGGGCAGGCAGGGTAGGTGG + Intergenic
1133839328 16:9394224-9394246 AAGGAGGCAGGAAGGGAAGGAGG - Intergenic
1133839333 16:9394240-9394262 AAGGAGGCAGGAAGGGAAGGAGG - Intergenic
1133839338 16:9394256-9394278 AAGGAGGCAGGAAGGGAAGGAGG - Intergenic
1133839361 16:9394320-9394342 AAGGAGGCAGGAAGGGAAGGAGG - Intergenic
1133839366 16:9394336-9394358 AAGGAGGCAGGAAGGGAAGGAGG - Intergenic
1133839380 16:9394376-9394398 AAGGAGGCAGGAAGGGAAGGAGG - Intergenic
1133839394 16:9394416-9394438 AAGGAGGCAGGAAGGGAAGGAGG - Intergenic
1133905538 16:10018877-10018899 CAGTGCTCAGATTGGGAAGGTGG - Intronic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134091219 16:11392565-11392587 CAGTGGGGAGCTACGGAAAGCGG - Intronic
1134238604 16:12487204-12487226 CATTGGGCTGGTAGTGAAGTGGG + Intronic
1134799683 16:17071956-17071978 CAGAAGGCAGGGAGGGAGGGAGG - Intergenic
1134839846 16:17393034-17393056 AAGTGGGCAGGAGGGGAAGGAGG - Intronic
1135049993 16:19185074-19185096 AAGCGGGAAGGGAGGGAAGGAGG - Intronic
1135061808 16:19277419-19277441 GAGGGGGCAGGAGGGGAAGGAGG + Intergenic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1135293580 16:21260764-21260786 AAGTGGGAGAGTAGGGAAGGAGG + Intronic
1135429042 16:22366633-22366655 TATTGGGCAGGGAGGGGAGGGGG + Intronic
1135692635 16:24555227-24555249 CAATGTGGAGGTAGGGATGGGGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1136184219 16:28576245-28576267 CACTGGGCGGGGAGGGTAGGAGG + Intronic
1136248535 16:28989100-28989122 CAGGGGGCAGGTGGGGATGGGGG + Intronic
1136513794 16:30755901-30755923 TAGTGGGTAGGTAGGGTTGGAGG + Intronic
1137237032 16:46625044-46625066 CAGAGGGCAGGGAGGCATGGGGG + Intergenic
1137373839 16:47933450-47933472 AAGAGGGCAGGAAGGGATGGAGG + Intergenic
1137679967 16:50332981-50333003 AAGGGGGCAGGGAGGGAAGGGGG + Intronic
1137697395 16:50470208-50470230 CAGTGGGCGGATGGGGGAGGGGG + Intergenic
1138245950 16:55467341-55467363 AATGGGGCAGGTAGAGAAGGTGG + Intronic
1138328677 16:56194675-56194697 GAGTGCGCAGGAGGGGAAGGAGG + Intronic
1138476145 16:57271716-57271738 CAGAGGGCAGGATGGGAACGGGG - Intronic
1138548058 16:57731069-57731091 CGGTGAGCAGGCAGGGCAGGTGG + Exonic
1138548886 16:57736260-57736282 CAGGGGGCAGGGAGAAAAGGGGG + Intronic
1139472676 16:67186694-67186716 CAGTGGGGAGGAGAGGAAGGAGG - Intronic
1139910213 16:70393046-70393068 CAGGGGCCAGGTAAGGAAGGGGG - Intronic
1139958597 16:70705123-70705145 CACTGGGCAGGTGGGGGCGGGGG - Intronic
1139997535 16:70995090-70995112 CAGGGGGCAAGCAGGGAGGGCGG - Intronic
1140175701 16:72657526-72657548 CAGAGGCCAGGAAGGGAAGGAGG + Intergenic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140615563 16:76658343-76658365 GAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1140850401 16:78930090-78930112 CAGACGGCAGGAAGGGAAGGAGG - Intronic
1141165440 16:81657594-81657616 CAGGGGCAAGGTCGGGAAGGGGG - Intronic
1141588015 16:85047962-85047984 CAGTGGGCAGGGAAGGGTGGCGG + Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141635382 16:85311497-85311519 CATTGGGGAGGGAGGGAGGGAGG + Intergenic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1141986637 16:87584641-87584663 CAGGGGTCAGGAGGGGAAGGGGG + Intergenic
1142014883 16:87740119-87740141 CAGGGGACAGGAAGAGAAGGTGG + Intronic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142256784 16:89017651-89017673 CGGGGGGCAGTTAGGGCAGGAGG + Intergenic
1142695161 17:1629234-1629256 CAGGGGGCAGCTGGGGACGGCGG - Intergenic
1142775898 17:2138711-2138733 CAGTGGACAGGGAGGGAGAGAGG - Intronic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1143026960 17:3946725-3946747 CAGTGGGCAGATGTGGAAGCAGG + Intronic
1143096429 17:4480850-4480872 AGGTGGGAAGGCAGGGAAGGGGG - Intronic
1143474867 17:7196771-7196793 CAGTGGGGAGCTGCGGAAGGGGG - Exonic
1143495670 17:7311327-7311349 CTGGGGGCAGATAGGGAAGGAGG - Intronic
1144059447 17:11569347-11569369 GGGTGGGCTGGTAGGGAAAGAGG + Intergenic
1144140621 17:12343701-12343723 CATTGGGCCTGTAGAGAAGGAGG - Intergenic
1144213088 17:13031690-13031712 CAGTGGCCAGGAAGGTAAGATGG + Intergenic
1144359525 17:14478601-14478623 GAGTGGTCAGCCAGGGAAGGCGG - Intergenic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144758197 17:17692978-17693000 CACTCTGCAGGTAGAGAAGGTGG + Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145066032 17:19761998-19762020 CAGAGGGAAGGTAGGCAAAGGGG + Intergenic
1146086333 17:29833714-29833736 AAGTAGGGAGGGAGGGAAGGAGG - Intronic
1146265647 17:31450914-31450936 GAGTGACCAGGTAGGGGAGGTGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146309110 17:31753548-31753570 CAGGAGGCAGGAAAGGAAGGGGG - Intergenic
1146675153 17:34768174-34768196 CAGTGGGCAGGTGGTGAGGAAGG - Intergenic
1146822555 17:35996057-35996079 CAGGAGGGAGGGAGGGAAGGGGG + Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147438140 17:40430647-40430669 GAGTGGGCTGGCAGGGTAGGTGG + Intergenic
1147566030 17:41536942-41536964 GAGGGGGCAGGTAGGCAGGGAGG - Intergenic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1148137113 17:45300645-45300667 CTGTGGGCAGGCAGAAAAGGAGG - Intronic
1148203708 17:45766326-45766348 CAGTAGGGAGGTGGGGAAGGCGG - Intergenic
1148210338 17:45804699-45804721 TATGGGGCAGGCAGGGAAGGAGG + Intronic
1148239052 17:45988082-45988104 CCGTGTGCAGCGAGGGAAGGAGG + Intronic
1148780907 17:50121238-50121260 CAGGAGGCAGGGAGCGAAGGAGG - Intronic
1148789592 17:50165981-50166003 CAGGGGGCAGGGAGGAGAGGAGG - Intronic
1148890488 17:50803500-50803522 CAGGGGGCAGGACTGGAAGGAGG - Intergenic
1149083866 17:52691016-52691038 CTGTTTGGAGGTAGGGAAGGAGG + Intergenic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1149866972 17:60156539-60156561 CACTGAGCAGGGAGAGAAGGTGG - Exonic
1150213163 17:63452626-63452648 AAGTGGGGAGGTGGGGATGGAGG - Intergenic
1150383746 17:64741145-64741167 CAGTGGAGAGGAAGGGAAGCTGG - Intergenic
1150772652 17:68054725-68054747 CAGTGGAGAGGAAGGGAAGCTGG + Intergenic
1150871445 17:68916129-68916151 TAGTGGGGTGGTGGGGAAGGGGG + Intronic
1151228458 17:72664365-72664387 CAGAAGGCAGGGAGGGAAAGTGG + Intronic
1151401125 17:73856794-73856816 CAGCGGGCATGTGGGGAGGGAGG + Intergenic
1151466852 17:74291120-74291142 CAATGGACAGATAGGTAAGGAGG + Exonic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152026781 17:77815102-77815124 AAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152636277 17:81431779-81431801 CAGAGGGCAGGGAGGGGATGAGG - Intronic
1152754140 17:82080079-82080101 TACTGGGCAGGAACGGAAGGGGG - Intronic
1152803769 17:82344856-82344878 CAATGGGGAAGTGGGGAAGGGGG + Intergenic
1152961918 18:84926-84948 CAGTTGGCAGGTGCTGAAGGTGG + Intergenic
1153321091 18:3774925-3774947 CAGTAGGCAGGGAGTGCAGGAGG - Intronic
1153605134 18:6825597-6825619 GAGGGGGGAGGTAGGGAAAGAGG - Intronic
1154225518 18:12500126-12500148 AAGTGGGGAGGTTGGGAGGGGGG + Intronic
1154259063 18:12813103-12813125 CAGGAAGCAGGCAGGGAAGGCGG + Intronic
1154435917 18:14341375-14341397 CAATGGGCAGGTGGGGATGGTGG + Intergenic
1155246259 18:23913026-23913048 CAGTGGGGAGGTGGGCAGGGAGG - Intronic
1156269378 18:35517025-35517047 CAGTGGGCAGACAGTGACGGTGG - Intergenic
1156466958 18:37353732-37353754 CAGTGGGCTGGTGGGGGCGGGGG + Intronic
1156494335 18:37516181-37516203 CAGGGGGCAGGAAGGGATGTTGG - Intronic
1156637469 18:39048887-39048909 CAGGAGGCAGGAAGGGAATGAGG + Intergenic
1156812055 18:41264215-41264237 CAGTGGGTGGGTGGGGAGGGGGG + Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157337255 18:46750520-46750542 CAGTGGGCAGGGAGTGAGTGGGG - Intronic
1157558915 18:48632541-48632563 CAGGGGGGAAGTGGGGAAGGAGG - Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1157750055 18:50170191-50170213 CAGTGGGCAGTGAGGAAAGGAGG + Intronic
1158233055 18:55280094-55280116 CAGAGAGGAGGTAGGGAGGGGGG + Intronic
1158376473 18:56875465-56875487 CAGTGGGAAGGTATGCAAGATGG - Intronic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159477245 18:68937751-68937773 CAGGGGGCTGGTGGGGTAGGGGG - Intronic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1159868233 18:73730970-73730992 GAGTGGGCAGGTGGTGAATGGGG - Intergenic
1160785664 19:899324-899346 TGGTGGGGAGGTGGGGAAGGGGG - Intronic
1160894065 19:1394657-1394679 CAGTCCGCAGGGAGGGAGGGAGG - Intronic
1160981220 19:1817460-1817482 TGGTGAGCAGGTGGGGAAGGGGG + Intronic
1161125298 19:2552849-2552871 CAGTGGGGAGGTGGGGGGGGTGG - Intronic
1161237342 19:3204528-3204550 CAGAGGGCAGGCGGGGATGGCGG - Intronic
1161321323 19:3643013-3643035 CAGGGGGCAGGTAGGCAGGCGGG - Intronic
1161323917 19:3653862-3653884 CTGTGGGCAGGCAGGGAGTGTGG - Intronic
1161370521 19:3908602-3908624 CAGTGAGGAGGAGGGGAAGGAGG - Intronic
1161390356 19:4017316-4017338 CAGCGGGCAGGTTGGGGAGCTGG - Intronic
1161665551 19:5574056-5574078 CTGTAGGCAAATAGGGAAGGAGG - Intergenic
1161995852 19:7710794-7710816 AAGGAGGCAGGGAGGGAAGGAGG - Intergenic
1162089421 19:8269228-8269250 CTGTTGGCAGGTGGGGATGGTGG - Intronic
1162310075 19:9900996-9901018 GAGGGGGGAGGGAGGGAAGGAGG + Intronic
1162322875 19:9980078-9980100 GAGTGGGCAGGGAGGCAGGGGGG - Intronic
1162420861 19:10565492-10565514 GAGTGGGCAGGTGGGGATCGTGG + Intronic
1162475479 19:10896861-10896883 TAGTGAGCAGATAGGGAAGTGGG + Intronic
1162573106 19:11483667-11483689 CAGTGGTCAGGTGGGTCAGGTGG + Exonic
1162671289 19:12259935-12259957 AAGAGGACAGGGAGGGAAGGTGG - Intronic
1162725642 19:12688523-12688545 CCGGGGGCAGGCAGGGAGGGAGG - Intronic
1162754161 19:12847319-12847341 CCGTGGGCTGGTAGGGCAGCTGG - Exonic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1162827530 19:13262876-13262898 CAGAGGTCAGGTTGGGTAGGGGG + Intronic
1163106053 19:15123620-15123642 CAGAGGGCAGCTGGGAAAGGGGG + Intronic
1163463395 19:17452699-17452721 GAGTGGGGAGGTGGGGATGGGGG + Intronic
1163785865 19:19274671-19274693 CAGTGGACACCTGGGGAAGGAGG - Intergenic
1163822733 19:19505505-19505527 CAGGGGCCAGGTGGGGGAGGAGG - Exonic
1164682960 19:30148079-30148101 CAGTGGCCAGGTGGGATAGGAGG + Intergenic
1164686216 19:30168392-30168414 CAGGGGGCGTGTAGGGAAGAGGG - Intergenic
1165101104 19:33439269-33439291 CAGGGGGCAGGAAGGCCAGGAGG - Intronic
1165152721 19:33770446-33770468 CGGTGGCCAGGTAGGGACTGGGG + Intronic
1165199766 19:34134398-34134420 CAGTTTGCAGCTAGGGAAGGTGG - Intergenic
1165335314 19:35165811-35165833 CACTGGGAAGGGAGTGAAGGAGG + Intronic
1165363489 19:35350743-35350765 CAGTGAGCCGGAAGGGGAGGAGG - Intergenic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166625085 19:44344477-44344499 CAGAGGCCAGGTGGGGCAGGAGG - Intronic
1166718699 19:44985423-44985445 CAGTGCTCAGGGAGGGGAGGTGG - Intronic
1166920710 19:46227210-46227232 GAGTGGGCATGTTAGGAAGGGGG + Intergenic
1168145557 19:54418646-54418668 CAGTGAGCAGGGAGGAGAGGGGG + Intronic
1168311766 19:55464357-55464379 GAGGGGGCTGGTGGGGAAGGTGG - Intergenic
1168542464 19:57224603-57224625 CAGTGGACAGCCATGGAAGGAGG + Intergenic
1168632925 19:57971435-57971457 AGGAAGGCAGGTAGGGAAGGCGG - Intronic
925034292 2:673896-673918 CAGGGGGAAGGTGGGGAGGGTGG + Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925939191 2:8799131-8799153 CAGTGGGATGGTAGGCATGGTGG - Intronic
926010029 2:9400244-9400266 AAGAGGGCAGGAGGGGAAGGGGG - Intronic
926060794 2:9803464-9803486 CAGGGGGCAGGTGGGGAGAGAGG - Intergenic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
928739887 2:34338816-34338838 GAGGGGGCAGGTAAGGCAGGAGG - Intergenic
928875899 2:36039109-36039131 CAGTGAGCAGGCAGGAAAAGAGG - Intergenic
929304848 2:40349333-40349355 GAGTGGGCAGGAAGAGAAAGAGG + Intronic
929431678 2:41892870-41892892 CAGAGAGAAGGAAGGGAAGGAGG + Intergenic
929604113 2:43224283-43224305 CAGTGAGGAGGAAGGGAAGGCGG - Exonic
929835999 2:45400250-45400272 CTGGGGGCAGGAAGGGCAGGAGG + Intronic
930195499 2:48505926-48505948 CAGTGGGCAGCCAGGAAAGCAGG + Intronic
930284539 2:49411484-49411506 CAGGGGACAGTTAGGAAAGGGGG - Intergenic
930290912 2:49491413-49491435 CAGTAGGCTGGATGGGAAGGTGG - Intergenic
930314441 2:49780443-49780465 CACTCTGCAGGTAGGAAAGGAGG + Intergenic
930601748 2:53451818-53451840 AAGGGGGCAGGGAGGGAACGGGG - Intergenic
931038458 2:58269078-58269100 CAGTGGGGGGGTAGGGCGGGCGG - Intergenic
932048644 2:68376919-68376941 CAGAGGCCAGGAAGGGAAGTGGG - Intronic
932194687 2:69773325-69773347 AAGTGAGGAGGCAGGGAAGGGGG - Intronic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932484570 2:72075949-72075971 CAGCAGGAAGGTAGGGAATGGGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933360881 2:81282553-81282575 GAGAGGGAAGGAAGGGAAGGAGG - Intergenic
933693585 2:85198367-85198389 GAGCTGGCAAGTAGGGAAGGGGG + Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934490073 2:94756449-94756471 CAACGGGCAGGTGGGGATGGTGG - Intergenic
935210861 2:100938554-100938576 AAGGGGGGAGGGAGGGAAGGAGG - Intronic
935303903 2:101718553-101718575 CAGTGGGAAGGTGGGGGTGGGGG + Intronic
935553587 2:104483370-104483392 CCGTGTGCTGGTGGGGAAGGTGG + Intergenic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
935591250 2:104847158-104847180 CAGTGGGGAGGCAGGGAGTGTGG + Intergenic
935756073 2:106276937-106276959 CCATGGGCAGGTTGGGAAGAGGG - Intergenic
935901639 2:107799171-107799193 GAGTGGGCTGCCAGGGAAGGAGG + Intergenic
935983786 2:108652879-108652901 CAGTGAGGAGGCAGGGAGGGAGG - Intronic
936136220 2:109896533-109896555 CAGTGAGGAGGCAGGGAGGGAGG - Intergenic
936208477 2:110474952-110474974 CAGTGAGGAGGCAGGGAGGGAGG + Intergenic
936836425 2:116715805-116715827 CAGAGGGTGGGAAGGGAAGGAGG + Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937225351 2:120365646-120365668 CAGTGAGCAGGTGGCCAAGGGGG + Intergenic
937891272 2:126940717-126940739 CAGTGGGAAAGTAATGAAGGCGG - Intergenic
938661230 2:133489094-133489116 AAGTCGGCAGGTAGTTAAGGGGG + Intronic
938730505 2:134143386-134143408 AAGTGGGCAGGGAGTGAAGTGGG + Intronic
938969269 2:136417255-136417277 CAGTGGGAAGTTAGGGCAGTAGG + Intergenic
939178655 2:138780395-138780417 GGGTGGGCGGGCAGGGAAGGGGG + Intergenic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
941471759 2:165896960-165896982 CAGGGCCCAGGTGGGGAAGGTGG - Intronic
941635645 2:167932393-167932415 CAGTGGACTGGAAGGGAAAGAGG - Intergenic
943555040 2:189392653-189392675 CAGGGAGGAGGTAGGGAAGATGG + Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
943774324 2:191748966-191748988 CAGAGGTCAGGTATGGGAGGTGG + Intergenic
943958767 2:194231232-194231254 CAGAGGGCAGTAAGAGAAGGAGG + Intergenic
944260130 2:197667948-197667970 CAGTGGGCTGGGTGGGTAGGAGG + Intronic
944621756 2:201522914-201522936 GAGTGGCCAAGTAGGGAAGCTGG - Intronic
944751088 2:202710693-202710715 CAGCAGGCAAGAAGGGAAGGGGG - Intronic
944814667 2:203363507-203363529 AAGTGGGGAGGTAGGACAGGAGG - Intronic
946519081 2:220446615-220446637 AAGGGGGCAGGGAGGGAGGGGGG - Intergenic
946800707 2:223413323-223413345 GGGTGGGAAGGTAGAGAAGGAGG - Intergenic
946899937 2:224362321-224362343 AGGTGGGAAGGAAGGGAAGGAGG + Intergenic
948257001 2:236575983-236576005 CAGGGGGAAGGAAGGGGAGGGGG - Intronic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948431786 2:237923379-237923401 CAGGGGGCTGGGAGGAAAGGAGG - Intergenic
948646912 2:239411136-239411158 ATGAGGGAAGGTAGGGAAGGTGG - Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948724983 2:239929050-239929072 CAGTGGGAAGGCACGGGAGGGGG - Intronic
948800178 2:240429923-240429945 GAGTGTCCAGGGAGGGAAGGAGG - Intergenic
948846345 2:240684484-240684506 CAGTGGACGGGTTGGGGAGGGGG - Intergenic
948863827 2:240765570-240765592 CGCTGGGCAGGTAGGGGAGGGGG - Intronic
949033825 2:241807601-241807623 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
949033941 2:241807882-241807904 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1168958332 20:1850067-1850089 GGGTGGGGAGGTGGGGAAGGAGG + Intergenic
1169532263 20:6498393-6498415 CAGTGACCAGGTAGAGAAGCCGG + Intergenic
1169755948 20:9043392-9043414 AAGTGGGCTGGAAGGGAAAGAGG + Intergenic
1170007047 20:11680768-11680790 TTGTGGGCAGATAGGGAGGGAGG + Intergenic
1170464659 20:16611661-16611683 GAGTGAGCAGGAAGGGAAGATGG + Intergenic
1171406783 20:24917149-24917171 AGGTGGGCAGGGATGGAAGGTGG - Intergenic
1171795341 20:29561881-29561903 GAGGGGGGAGGTGGGGAAGGTGG - Intergenic
1171798105 20:29582134-29582156 CAGTGGTCAGGCAGGGAGTGGGG - Intergenic
1172122003 20:32604016-32604038 GAGGGGGCAGGATGGGAAGGTGG - Intronic
1172126337 20:32627213-32627235 CTGTGGGCAGGTCGGGGAGTGGG - Intergenic
1172520017 20:35560249-35560271 CCGTGGGCAGGTAGTCAAAGCGG + Intergenic
1173219038 20:41116140-41116162 AAGTGGGAAGTTAGGGAAAGAGG - Intronic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173870877 20:46341473-46341495 GAGTGGGCAGGGAGGGACGGGGG - Intergenic
1175222852 20:57427139-57427161 CAGTGGGCCTGTGGGGGAGGGGG + Intergenic
1175224815 20:57439073-57439095 CAGAGGGCAGCTAGGGAAGCCGG - Intergenic
1175254037 20:57628132-57628154 GAGGGGGCAGGAAGGGAAGTGGG + Intergenic
1175283493 20:57820987-57821009 CAGAGGGCAGGGGTGGAAGGGGG + Intergenic
1175284772 20:57830689-57830711 CAGTGGTCAGGCAGAGAGGGCGG + Intergenic
1175326021 20:58129096-58129118 ACGTGTGCAGGTGGGGAAGGAGG - Intergenic
1175346424 20:58280102-58280124 CACTGGGCAGCTACGGAATGCGG + Intergenic
1175499886 20:59442173-59442195 GAGTGGGGAGAAAGGGAAGGAGG - Intergenic
1175597991 20:60250701-60250723 CAGTGAGCAGGCAAGGAAGCAGG + Intergenic
1175815582 20:61881649-61881671 CAGAGGGCAGGAAGAGGAGGGGG + Intronic
1175889056 20:62308091-62308113 CAGATGGCAAGTAGGGAAGCAGG - Exonic
1175983359 20:62752443-62752465 GGGTGGGCAGGTGGGGGAGGCGG + Intronic
1176212783 20:63933190-63933212 CAGCAGGCAGGCAGGGAAGGGGG - Exonic
1176902860 21:14464524-14464546 CAGTGGGGAGGAAGGGGAAGGGG + Intergenic
1177794175 21:25755594-25755616 CAGGGAGGAGGTAGAGAAGGTGG + Intronic
1178666034 21:34547330-34547352 CAGTGAGCAGGTGAGGGAGGGGG - Intronic
1179044148 21:37830016-37830038 AAGTGGGCAGGTGGAGGAGGCGG - Intronic
1179049799 21:37879439-37879461 CAGTGGGCAGAGTGGTAAGGGGG + Intronic
1179237816 21:39562995-39563017 CAGTGTGCAGTTATGGCAGGTGG - Intronic
1179242169 21:39602097-39602119 CAGCGGGTTGGTGGGGAAGGTGG + Intronic
1179296843 21:40070326-40070348 AAGAAGGAAGGTAGGGAAGGAGG + Intronic
1179653114 21:42827563-42827585 TAGTGGGAGGGTAGGGGAGGTGG - Intergenic
1180035878 21:45248948-45248970 GAGGGGGCAGGAGGGGAAGGCGG + Intergenic
1180103607 21:45601937-45601959 CAGGGGGCAGGTGGGGTTGGGGG + Intergenic
1180128062 21:45805382-45805404 CACAGGGCAGGTGGGCAAGGGGG - Intronic
1181033089 22:20157546-20157568 CAGTGGGCAGCTGGGGCTGGGGG + Intergenic
1181320757 22:22004318-22004340 CTGTGGGTGGGTAGGAAAGGGGG - Intergenic
1181510220 22:23385691-23385713 CAGTGGGCAGCTGGGGCTGGGGG - Intergenic
1181601235 22:23953013-23953035 CAGTGAGCAGGAAGAGCAGGAGG + Intergenic
1181736085 22:24882664-24882686 CAGAGGGTAGGAAGGGAAGGAGG - Intronic
1181761333 22:25060670-25060692 CACTGGGCAGGTAGCACAGGTGG + Intronic
1182050698 22:27310593-27310615 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182050708 22:27310612-27310634 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182676239 22:32042130-32042152 CAGTGGGCAGGGAGGGCCTGAGG + Intergenic
1183064181 22:35352421-35352443 CAGGGGGCAGGGAGTGGAGGCGG - Intergenic
1183174843 22:36215607-36215629 CAGTGGGCAGGAGGAGAAAGAGG - Intergenic
1183259058 22:36782543-36782565 AAGGGGGCAGTGAGGGAAGGCGG - Intergenic
1183280309 22:36928764-36928786 CAGCCTGGAGGTAGGGAAGGGGG + Intronic
1183354363 22:37350533-37350555 CGGTGGGGAGGCAGGGAAAGAGG - Intergenic
1183361238 22:37384501-37384523 CAGGGGTCAGGTTGGGAAGGTGG - Intronic
1183362110 22:37388080-37388102 GAGTGGGGAGGTAGGGTTGGAGG - Intronic
1183698772 22:39438103-39438125 GAGTGAGGAGGGAGGGAAGGGGG - Intergenic
1183720720 22:39559962-39559984 GAGTGGTCAGGTAGGGGTGGAGG + Intergenic
1183725938 22:39589806-39589828 GATCGGGGAGGTAGGGAAGGTGG - Intronic
1184128149 22:42501810-42501832 AAGTGGGCAGGAAGGTGAGGGGG + Intergenic
1184136939 22:42555123-42555145 AAGTGGGCAGGAAGGTGAGGGGG + Intronic
1184164056 22:42717079-42717101 CACTGGTCTGGAAGGGAAGGGGG + Intronic
1184281668 22:43440933-43440955 CAGTGGGCAGGAGGGGAATGAGG - Intronic
1184645985 22:45895776-45895798 CTGAGGTCAGGCAGGGAAGGTGG + Intergenic
1184806679 22:46799127-46799149 CTGTGGAAAGGAAGGGAAGGTGG - Intronic
1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG + Intergenic
1184989278 22:48156220-48156242 CAGTGGGTAGGGAGAGAGGGAGG - Intergenic
1185031126 22:48443557-48443579 AAGGGGGCAGGGAGGGAGGGAGG + Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185279444 22:49963693-49963715 CAGTGGGGAGGCAGGGGAGGGGG + Exonic
949987431 3:9552261-9552283 CTCTTGGCAGGTAGGGGAGGGGG - Exonic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950106590 3:10392651-10392673 CTGTGGGCAGTTAGAGGAGGTGG - Intronic
950339145 3:12226660-12226682 CAGAGGCCAGGAAGGGTAGGAGG + Intergenic
950532653 3:13561484-13561506 CAGCCGGCATGCAGGGAAGGAGG - Intronic
950700029 3:14737260-14737282 AAGTGGAAAGGTGGGGAAGGAGG - Intronic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
951955610 3:28249932-28249954 CAGTGAGCGGGGAGGGATGGGGG + Intronic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952749714 3:36815426-36815448 CAGGGGGCTGTTAGGAAAGGGGG + Intergenic
953025436 3:39142293-39142315 CAGAGGGCAGGAAGTGGAGGGGG + Exonic
953280383 3:41548658-41548680 TAGTGGGCAGGGAGGGTGGGTGG - Intronic
953284695 3:41595276-41595298 CAGTGGGCAGGAAGAGGAAGAGG - Intronic
953533345 3:43757677-43757699 CAGTGGGCTGGTGGCGAAAGAGG - Intergenic
953536995 3:43784068-43784090 GAGATGGCAGGTGGGGAAGGAGG + Intergenic
953636618 3:44670161-44670183 CTGAGGGCAGGTGGGGAAGAGGG + Intergenic
953796663 3:45991456-45991478 CAGAGGGGAAGAAGGGAAGGAGG - Intronic
954881087 3:53836402-53836424 CCCTGGGGAGGAAGGGAAGGTGG - Intronic
955142652 3:56285098-56285120 CTGGGGGGAGGTAGGGATGGGGG - Intronic
955695584 3:61632805-61632827 CCATGGGCAGGGAGGGGAGGGGG - Intronic
955740662 3:62088094-62088116 AAGTGGGGAGGGAGGGAATGGGG + Intronic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956963053 3:74425229-74425251 CAGTGGGGAGGAAGGGAGAGGGG - Intronic
957072124 3:75575642-75575664 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
958602499 3:96315392-96315414 CAGTGGGCAACTAGGGGAAGGGG - Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959849581 3:111071433-111071455 CATTGGAAAGGCAGGGAAGGGGG + Intronic
960648795 3:119922187-119922209 AGGTAGGTAGGTAGGGAAGGAGG + Intronic
960690202 3:120338903-120338925 CTGTGGGCAGGAATAGAAGGAGG + Intronic
961084416 3:124054436-124054458 TAGCAGCCAGGTAGGGAAGGAGG - Intergenic
961282017 3:125771443-125771465 ATGTGGGCAGGCAGGGTAGGTGG + Intergenic
961750150 3:129089741-129089763 CAGAGGGCAGGGAGGCATGGGGG + Exonic
962161618 3:133006535-133006557 CAGAGGGCAGACAGGCAAGGGGG + Intergenic
962251911 3:133840826-133840848 CCCTGGGAAGGTAGGCAAGGGGG - Intronic
963087408 3:141451017-141451039 CAGTGGGCAAGCAAAGAAGGGGG + Intergenic
963851124 3:150211368-150211390 AGGTGGGCAGGCAGGGAAGAAGG + Intergenic
963947384 3:151161167-151161189 GAGTGGGGAGGTAGGAAAGGAGG + Intronic
964852351 3:161108441-161108463 CATTTGGCAGGTAGGGAAACTGG + Intronic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
967248398 3:187512522-187512544 CAGAGGGCAGAGAGGGAAAGAGG + Intergenic
967709133 3:192685598-192685620 AAGGGGAAAGGTAGGGAAGGAGG + Intronic
968229258 3:196995663-196995685 AAGAGGGCAGGAAGAGAAGGAGG + Intronic
968286888 3:197514073-197514095 CTGTGGCCGGGTAGGGGAGGAGG - Intronic
968485878 4:861345-861367 CAGTGGGCAGCTGAGGAAGGAGG + Intronic
968612268 4:1562708-1562730 CAGTGGTCAGGAAGGGAACCTGG + Intergenic
968659609 4:1793633-1793655 CAGCAGCCAGGGAGGGAAGGGGG + Intronic
969015714 4:4102963-4102985 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
969145777 4:5123085-5123107 CTGTGGGGAGGTGGGGAAGTTGG - Intronic
969257279 4:6011059-6011081 CAGTGGGCAGTTAAGGGTGGGGG - Intergenic
969303459 4:6311031-6311053 CAATGGGCAGATAGGTAAGCGGG + Intergenic
969620698 4:8277377-8277399 CAGTGGGCAGGAAGCAAATGAGG - Intronic
969738248 4:9005398-9005420 ATGTGGGCAGGCAGGGCAGGTGG + Intergenic
970001119 4:11367075-11367097 AAGGAGGCAGGGAGGGAAGGAGG + Intergenic
971503183 4:27338519-27338541 CATAGGGCAGGGAGGGAGGGAGG + Intergenic
973171111 4:47145156-47145178 TAGTGAGCAGGTAGCCAAGGGGG + Intronic
973599852 4:52531520-52531542 AAGAGTGCAGGTAGAGAAGGGGG - Intergenic
973639773 4:52891352-52891374 CAGTGGGTAAGTAAGGAAGGTGG + Intronic
975436116 4:74353803-74353825 AAGTGGGCAGGAAGGGAAAGGGG + Intergenic
976136678 4:81945107-81945129 CTGTGGGGAGGTGGGGATGGGGG + Intronic
979217142 4:118179500-118179522 AAGTGGTAAGGGAGGGAAGGTGG + Intronic
980384131 4:132063759-132063781 CAGTGAGGAGGTAAGGAGGGAGG - Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
981291770 4:143084667-143084689 CAGAGTGCAGGTAGGGGATGTGG - Intergenic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
982468894 4:155762227-155762249 CAGAGGGTAGGGAGGGGAGGAGG - Intronic
982475865 4:155849847-155849869 CAGTAGGCAGGTATGAAAAGTGG - Intronic
982499106 4:156131261-156131283 CAGTGGGAAGGAAGGGGATGAGG - Intergenic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
984904866 4:184617160-184617182 CAGGGGGCAGGTAGCCATGGGGG + Intergenic
985381197 4:189396671-189396693 CAGTGGGGAGGTAGAGTATGAGG + Intergenic
985635117 5:1032092-1032114 CAGTGGGCAGGCGGGGGAGATGG - Intronic
985954202 5:3250558-3250580 GAGCAGGCAGGTGGGGAAGGAGG + Intergenic
986184563 5:5423276-5423298 CCGAGGCCGGGTAGGGAAGGTGG - Intronic
986792319 5:11173945-11173967 AAGTGGGCAGGCAAGGTAGGAGG + Intronic
987373956 5:17217563-17217585 CACTGGGCAGGAAGGGGAGGGGG + Exonic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988784666 5:34555431-34555453 CAGTGGCCAGTTAGTGGAGGGGG + Intergenic
989099974 5:37814125-37814147 CAGTGGGTGGGCAGGGATGGAGG + Intronic
989159127 5:38373401-38373423 CAGCGGGGAGGTTGGGAGGGAGG - Intronic
990807658 5:59684171-59684193 CAGTGCTCAGGGAGGGATGGAGG - Intronic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
990816752 5:59794477-59794499 CAGGAGGGAGGGAGGGAAGGAGG - Intronic
991398484 5:66229115-66229137 CATTGAGCAGGTTGAGAAGGAGG + Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
992252398 5:74888446-74888468 TAGTGAGCAGGAAGGGAAGGAGG - Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
995060350 5:107806411-107806433 CAGAGAGCTGGTAGGGATGGAGG - Intergenic
996520552 5:124421063-124421085 TAGTCAGCAGGTAGTGAAGGTGG - Intergenic
996885959 5:128353985-128354007 CAGTGGGGAGACAGGGAGGGAGG - Intronic
997234476 5:132264864-132264886 AAGAGGGCAGATAGGGAAGCTGG - Intronic
997391215 5:133518485-133518507 CAAAGGACAGGTGGGGAAGGGGG + Intronic
998601097 5:143586022-143586044 AAGTGAACAGGGAGGGAAGGAGG - Intergenic
999197445 5:149792075-149792097 GAGTGGCCTGGGAGGGAAGGTGG + Intronic
999374395 5:151076671-151076693 CAGTGGTCAGGTAAGCAATGAGG + Intronic
1000014959 5:157267796-157267818 CAGTGGGCTGGAAGTGGAGGTGG + Intronic
1000052623 5:157575732-157575754 CAGTGGGCAGGTATGGCTGAGGG - Exonic
1000525772 5:162355786-162355808 CAGAGGCCTGGAAGGGAAGGGGG - Intergenic
1000573102 5:162939336-162939358 CAGAGGGCAGGAAGGGAATGGGG + Intergenic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001110813 5:168894654-168894676 CAGTGGGAAGGTAGGCTAAGTGG + Intronic
1001273240 5:170331589-170331611 GTGTGGGGAGGTGGGGAAGGAGG + Intergenic
1001295505 5:170496086-170496108 AAGTGAGCAGGGAGGGGAGGAGG - Intronic
1002841978 6:914071-914093 CAGAGGCCAGGATGGGAAGGGGG - Intergenic
1003113951 6:3271010-3271032 CAGTAGGCAGTTGGGGAAGGTGG - Exonic
1003173217 6:3736366-3736388 TGGTGGACAGGGAGGGAAGGGGG - Intronic
1003563251 6:7201508-7201530 CAGTGGGGAGGGTGGGATGGGGG - Intronic
1003872204 6:10412419-10412441 GAGAGGGGAGGGAGGGAAGGAGG + Intronic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004024666 6:11806853-11806875 CAGTGGTCAGGCAGGGAGGAAGG + Intronic
1004367979 6:15028041-15028063 GAGTGGACAGGAGGGGAAGGAGG + Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004662111 6:17719771-17719793 CAATGGGCAGGTGGAGAGGGTGG + Intergenic
1005036634 6:21561373-21561395 CAGTGGGCAGGGCTGGAAGTGGG - Intergenic
1005898335 6:30196750-30196772 CAGGGGGCAGGAAGGGGAGAAGG + Intronic
1005935138 6:30515523-30515545 CAGTGGGTTGGTAGGGATCGGGG - Intergenic
1005942822 6:30573560-30573582 CAGGAAGCAGGTGGGGAAGGAGG + Intronic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006338610 6:33433580-33433602 GATTGGGCAGGTAGGGAGGTTGG + Intronic
1006431511 6:34000176-34000198 CAGAGGGAAGGAAGGGGAGGGGG + Intergenic
1006583325 6:35089055-35089077 CAGTGGGTCGGAAGAGAAGGCGG + Exonic
1006638661 6:35477406-35477428 CAGGTGGAAGGTAGGGAAGAGGG - Intronic
1006885024 6:37374412-37374434 GAGAGGGCAGTTAGGGAAGGCGG - Intronic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1006946092 6:37785345-37785367 AGGTGGGCAGGCAGGGACGGGGG + Intergenic
1007741060 6:44009679-44009701 AAGTGGGGAGGTAGGAAGGGAGG + Intergenic
1007786557 6:44283364-44283386 CAGTGGGGAGGTGGAGAAGCAGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007934356 6:45720082-45720104 CATTGGGCAGGAGGTGAAGGGGG - Intergenic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010141814 6:72621852-72621874 CCGGGGGCAGTTTGGGAAGGAGG + Exonic
1010686527 6:78859937-78859959 GTGTGTGGAGGTAGGGAAGGCGG - Intergenic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1011557848 6:88588141-88588163 CAGTGGGTGGGTTGGGAAGCGGG - Intergenic
1012314333 6:97767201-97767223 CAGGGGGCAGGGTGGGGAGGGGG - Intergenic
1012695517 6:102377134-102377156 GAGAGGGGAGGAAGGGAAGGAGG - Intergenic
1012848919 6:104424157-104424179 CAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1012848935 6:104424209-104424231 CAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1012848960 6:104424293-104424315 CAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1012848976 6:104424341-104424363 CAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1012848993 6:104424393-104424415 CAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1013286312 6:108685192-108685214 CAGTATGCAGGTCGGGCAGGAGG - Intergenic
1013468290 6:110436891-110436913 CAGTTGGCAGATGGGGGAGGAGG - Intronic
1013739111 6:113262718-113262740 GAGAGGGTAGGAAGGGAAGGGGG + Intergenic
1015747509 6:136526186-136526208 GAGGGGGCTGGTAGGGGAGGTGG - Intronic
1015765669 6:136713340-136713362 CAGTGGGCAAGGAGTGAGGGTGG + Intronic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1017493322 6:154962891-154962913 CAGAGGGCACATGGGGAAGGTGG + Intronic
1017824874 6:158074090-158074112 GACTGGGCAGGATGGGAAGGAGG + Intronic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018787422 6:167119054-167119076 CAGTGGGGAGCTGGGGAGGGTGG - Intergenic
1018801292 6:167224344-167224366 AAGTGAGCAGGAAGGGAAAGAGG - Intergenic
1019117152 6:169774425-169774447 AGGTGGGCAGGTAGGGAGGAGGG + Intronic
1019140203 6:169938021-169938043 CAGGGGGCAGGTGAGGGAGGAGG - Intergenic
1019140417 6:169938970-169938992 CACTGGGCAGGTCGGGACTGAGG - Intergenic
1019290309 7:247021-247043 AAGGAGGCAGGGAGGGAAGGGGG + Intronic
1019313493 7:374117-374139 CAGAGGGAAGGAAGGGAGGGAGG + Intergenic
1019368853 7:650374-650396 GAGTGAGCAGGGAGGGAGGGAGG - Intronic
1019667234 7:2257951-2257973 GGGTGGGCTGGTGGGGAAGGGGG - Intronic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1020129813 7:5553427-5553449 CAGTGGGCAGGTGGGGGCAGAGG - Intronic
1020641164 7:10755377-10755399 CAGGGGGCAGGTAGTGAAAAGGG + Intergenic
1020877264 7:13713516-13713538 AAGGGGGAAGGGAGGGAAGGAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021726814 7:23555250-23555272 CAGAGGCCAGGAAGGGTAGGAGG - Intergenic
1021847298 7:24775535-24775557 GGGCAGGCAGGTAGGGAAGGAGG - Intergenic
1021888552 7:25164773-25164795 CAGGGGGAAGGTTGGGAAAGGGG - Intronic
1022090002 7:27102004-27102026 GAGTGGGCTGGGAGAGAAGGAGG - Intronic
1023393608 7:39732892-39732914 CAGTGTGCATGGCGGGAAGGAGG - Intergenic
1023582703 7:41699810-41699832 CGGAGGGCAGGCAGGGGAGGGGG - Intronic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1024506549 7:50167092-50167114 GAGGAAGCAGGTAGGGAAGGAGG + Intergenic
1024583998 7:50825152-50825174 TACGGGGCAGGCAGGGAAGGAGG - Intergenic
1024969924 7:55059605-55059627 GAGTGAGCAGGTGGGGAAGGAGG - Intronic
1025635583 7:63317178-63317200 TGGTGGGGAGGTAGGAAAGGTGG - Intergenic
1025647113 7:63430992-63431014 TGGTGGGGAGGTAGGAAAGGTGG + Intergenic
1026117911 7:67511841-67511863 GAGCAGGCAGGAAGGGAAGGAGG - Intergenic
1026919388 7:74144185-74144207 GAGTGGGCAGGAGGGGAAGGAGG - Intergenic
1027733577 7:81905214-81905236 CAGGAGGGAGGAAGGGAAGGAGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029074383 7:97924597-97924619 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1029438608 7:100575547-100575569 CAGGGGGCATGCAGGGCAGGGGG + Intronic
1029540380 7:101179288-101179310 CAGGGGACAGGCAGGGAAGCCGG + Intronic
1029557550 7:101280802-101280824 CAGTGAACAGGGAGGAAAGGGGG + Intergenic
1030139908 7:106293738-106293760 CAGTGGGCAGGGTGGGGCGGGGG - Intergenic
1030496752 7:110310346-110310368 GGATGGGCAGGTAGAGAAGGAGG + Intergenic
1031227253 7:119055211-119055233 CAGTAGGCAGGTATGAAAGTGGG + Intergenic
1031524707 7:122810244-122810266 AAGTGGGAAGGTAAGTAAGGAGG + Intronic
1031838930 7:126713439-126713461 CTGTTGGCAGGTAGGGAACAAGG + Intronic
1031976247 7:128095410-128095432 CTGTGAGCAGGTGGGGAAGAAGG + Intergenic
1033048527 7:137983661-137983683 GAGTGGCCAGGCCGGGAAGGTGG - Intronic
1033137722 7:138798624-138798646 CAAGGGGCAGGGAGGGATGGAGG - Intronic
1033357725 7:140614010-140614032 CAGTGAGCAGGAGGGGAAGGAGG - Intronic
1033365502 7:140670430-140670452 CAGGAGGAAGTTAGGGAAGGGGG + Intronic
1034223428 7:149462366-149462388 CAGTGAGCAGTTCGGGAAGCCGG - Intergenic
1034381978 7:150705150-150705172 GAGTGGGGAGGGTGGGAAGGGGG + Intergenic
1034436320 7:151064370-151064392 GAGGGGGCAGGCAGGGGAGGGGG + Intronic
1034442372 7:151092486-151092508 CAGAGTTGAGGTAGGGAAGGGGG + Intronic
1034697454 7:153066468-153066490 AGGTGGAGAGGTAGGGAAGGAGG + Intergenic
1034941298 7:155232068-155232090 CAGTGGGCAGCCAGGGGTGGAGG - Intergenic
1034964456 7:155382777-155382799 CAGGGGGCAGGCCGGGAGGGAGG + Intronic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1035376339 7:158409331-158409353 CAGTGAGCAGGCTGGGGAGGTGG + Intronic
1035413977 7:158667921-158667943 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035414046 7:158668123-158668145 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1036432153 8:8701838-8701860 CGGTGGGCGGGGAGGGAAAGAGG - Intergenic
1036702584 8:11022961-11022983 CTGTGGCCAGGAAGGGAGGGAGG - Intronic
1036734271 8:11295840-11295862 CAGTGAGTAGGTAGGGACTGGGG + Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036780629 8:11644587-11644609 TAGTGGGCAGGTGGGGTGGGAGG - Intergenic
1036829407 8:12010499-12010521 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1036898507 8:12654737-12654759 ATGTGGGCAGGAAGGGCAGGTGG - Intergenic
1037077044 8:14733172-14733194 CCTGGGGCAGTTAGGGAAGGTGG - Intronic
1037606127 8:20438644-20438666 CAGAGGGCAGGATGGGAAGAGGG + Intergenic
1037772301 8:21809668-21809690 CAGGGGCCAGGTAGGGAACTGGG - Intronic
1037837068 8:22220722-22220744 CGGTGGGCAGGTGGAGAAGGAGG + Exonic
1037841589 8:22248985-22249007 CAGTGAGCTGGTATGGAGGGTGG + Intronic
1037855866 8:22370253-22370275 GTGTGAGCAGGTAAGGAAGGAGG - Intronic
1037902739 8:22697137-22697159 CAGGAGGGAGGAAGGGAAGGAGG - Intergenic
1038267169 8:26046180-26046202 TAGTGGGCGGGGAGGGACGGGGG + Intergenic
1038283249 8:26184243-26184265 CAGCAGGCAGGCAGTGAAGGGGG - Intergenic
1038657669 8:29468959-29468981 GAGTGGTCAGATTGGGAAGGAGG - Intergenic
1039419072 8:37420463-37420485 CAGTGGGCAGGCGGGGGAGGGGG - Intergenic
1039473099 8:37826120-37826142 AAGTGAGCGGGGAGGGAAGGGGG + Intronic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040629260 8:49190797-49190819 GAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1040698294 8:50029500-50029522 CAGAGGGCAGGAAGAGAAGTGGG - Intronic
1040899644 8:52404627-52404649 CAGGGGGCAGTGAGGGAAAGAGG - Intronic
1041192427 8:55367133-55367155 CGGTGGGCACACAGGGAAGGAGG - Intronic
1041537161 8:58939468-58939490 GAGTGGTCTGGGAGGGAAGGAGG + Exonic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041775140 8:61514961-61514983 GGGTGGACAGGGAGGGAAGGAGG + Intronic
1041827232 8:62109526-62109548 CAGTGGGAAGGTGGGGTGGGTGG + Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042529887 8:69803972-69803994 CAGTGGTGAGGTGAGGAAGGGGG - Intronic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1044249662 8:89990995-89991017 AAGTGGTCAGGAAGGGAAAGAGG + Intronic
1044581212 8:93828014-93828036 CAGCAGGCAGGTAGAGAAGCTGG + Intergenic
1044601694 8:94011676-94011698 GAGTGGGGAGGTGGGGAAGAGGG + Intergenic
1044778168 8:95715558-95715580 AAGGAGGGAGGTAGGGAAGGAGG - Intergenic
1045323634 8:101100829-101100851 CTGAGGACAGGTAGAGAAGGGGG - Intergenic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1045557396 8:103227762-103227784 GAGTGGGCAGTAAGGGAAAGAGG - Intronic
1045658008 8:104406651-104406673 AAGTGGTCAGGAAGGGAAGATGG - Intronic
1047255653 8:123211696-123211718 GAGTGGGCAGTAGGGGAAGGTGG - Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048201746 8:132380505-132380527 AAGTGGGCAGCTTGGGAAGCAGG - Intronic
1048426059 8:134324479-134324501 CAGTGAGCAGGTAGATAAGATGG - Intergenic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049231712 8:141488235-141488257 GAGGGAGCAGGGAGGGAAGGAGG - Intergenic
1049298540 8:141856598-141856620 CTGTGGGCTGGAAGGGCAGGAGG + Intergenic
1049405652 8:142450831-142450853 CAGTGGAAAGGTAGACAAGGAGG - Intronic
1049480062 8:142818351-142818373 CAGTGGGCAGGCAGCAGAGGAGG - Intergenic
1049521610 8:143094317-143094339 CCCTGGGCAGGTCGGGAGGGAGG + Intergenic
1049908586 9:243659-243681 CAGGGGAAAGGTAGGGAAGAAGG - Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1051885048 9:21883761-21883783 TAGTGTACAGGTAGGGAAGCAGG + Intronic
1052340430 9:27359459-27359481 CAGTGGCCATATAGGGATGGAGG + Intronic
1052860744 9:33436462-33436484 CAGAGGGCAGGAAGGGTGGGGGG - Intergenic
1053010842 9:34632202-34632224 CAGTGAGCAGGAATTGAAGGAGG + Intergenic
1053418829 9:37964037-37964059 CACTGGGCAGGTGGGGTAGGTGG - Intronic
1054946809 9:70804626-70804648 CAGACGTCAGGTAGGTAAGGAGG - Intronic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055449503 9:76418132-76418154 AAGTGGGCAGAGAGGGGAGGAGG + Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1055965217 9:81859332-81859354 AAGTGGGGAGGGAGGGGAGGGGG + Intergenic
1056964137 9:91152110-91152132 CAGAGGGGAGGAAGGGAGGGAGG - Intergenic
1057102643 9:92377487-92377509 CTGTGGCCAGGTAGGGAGTGTGG + Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057310096 9:93937354-93937376 AAGTGTGCAGGGAGGGAGGGTGG + Intergenic
1058132698 9:101270898-101270920 TAGAGGGCAGGTAGGGGAGGAGG - Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059437019 9:114283058-114283080 CAGGGGGAAGCCAGGGAAGGAGG + Intronic
1059456361 9:114402610-114402632 CAGTGGGCTGGGATGGAGGGGGG + Exonic
1060820399 9:126658415-126658437 CAGGCGGCAGGGAGGGCAGGGGG - Intronic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1060949845 9:127594675-127594697 CAGGGAGCAGGTAGACAAGGGGG - Intergenic
1060990322 9:127845271-127845293 CTGTGGGAAGGTGAGGAAGGAGG - Intronic
1061179173 9:129013883-129013905 CAGTGAGCTGGGAGTGAAGGGGG + Intronic
1061682524 9:132250095-132250117 CTGTGGGCAGGAGGGGAAAGGGG - Intergenic
1062338725 9:136084056-136084078 GAGCGGGGAGGTAGGGAAGGTGG + Intronic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062466715 9:136684886-136684908 CGGGGGGCTGGAAGGGAAGGAGG - Intronic
1062475756 9:136726264-136726286 CACCCGGCAGGCAGGGAAGGAGG + Intergenic
1062694895 9:137868786-137868808 CTCTGGGCAGGTGGGGAAGGGGG + Intronic
1062736226 9:138139174-138139196 CAGTTGGCAGGTGCTGAAGGTGG - Intergenic
1185600708 X:1336961-1336983 AAGAGGGCAGGCAGGGGAGGCGG + Intronic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1186079293 X:5912897-5912919 CAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186114628 X:6292566-6292588 CAATGAGCTGCTAGGGAAGGTGG - Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186795476 X:13043790-13043812 CCGTGGGCAGGAAGGGCAGCAGG - Exonic
1187481012 X:19655665-19655687 AAGTGGGGAGGAAGGGAGGGGGG + Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187945616 X:24423796-24423818 CAGCAGGCAGGTTGGGAAAGAGG + Intergenic
1188053767 X:25517796-25517818 CACTGGGAAGGAAGGGAGGGAGG + Intergenic
1188065520 X:25654878-25654900 CTGTGGGCAGGTAGTTGAGGAGG - Intergenic
1188518326 X:31011122-31011144 CAGTGGGCAGGAGAGGAAGTTGG + Intergenic
1190260033 X:48791818-48791840 TTGGGGGCAGGTAGGGATGGAGG - Intronic
1190741105 X:53289331-53289353 CAGTGGGGAGCTGGGGAAGTTGG - Intronic
1191110621 X:56800863-56800885 CAGAAGGCAGATAGGGGAGGGGG - Intergenic
1192088525 X:68127090-68127112 CAGAGGACAGGAAGGGTAGGAGG + Intronic
1192429820 X:71104241-71104263 CAGTCGGCTGGTAGGGAGAGGGG + Intronic
1192899983 X:75486514-75486536 AGGTGGGCAGGCAGGCAAGGAGG + Intronic
1193261361 X:79410333-79410355 CATTTGGCAGATAGGGAAGCTGG - Intergenic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1194110270 X:89824827-89824849 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1194320433 X:92440300-92440322 GAGTGGGGAGGGAGGGAGGGAGG - Intronic
1196297927 X:114020418-114020440 GAGTGGGCAGGAAGGAAAAGAGG - Intergenic
1196874059 X:120141257-120141279 ATGGGGGGAGGTAGGGAAGGGGG - Intergenic
1196978951 X:121190653-121190675 CAGTGGGCAAGGAGTGAAGGTGG - Intergenic
1197802417 X:130365489-130365511 AAGTGGGCAGGGAGTGAAAGTGG + Intronic
1197824998 X:130579942-130579964 AAGTGGGGAGGTAGGGAATGAGG - Intergenic
1198019484 X:132644213-132644235 AAGGGGGGAGGGAGGGAAGGAGG + Intronic
1198080802 X:133237420-133237442 CGGTGGGGAGGAAGAGAAGGAGG + Intergenic
1198499235 X:137226205-137226227 AAGTGGCCAGGAAGGGAAGAAGG - Intergenic
1198934758 X:141894866-141894888 GAGTGGGGAGGTAGGCAAGAAGG + Intronic
1200082597 X:153585890-153585912 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1200398462 X:156005240-156005262 CAGTTAGCAGGTGGTGAAGGTGG - Intronic
1200462931 Y:3479568-3479590 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1200745485 Y:6900268-6900290 CTGTGGGCAGGCGGGCAAGGAGG + Intergenic
1201287607 Y:12392485-12392507 CATTGAGGAGGTAGGGGAGGCGG - Intergenic