ID: 1067934051

View in Genome Browser
Species Human (GRCh38)
Location 10:50593062-50593084
Sequence CTCTGTTTTCGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067934044_1067934051 -3 Left 1067934044 10:50593042-50593064 CCAAAGACTCCACCTTCCATCTC 0: 1
1: 0
2: 1
3: 23
4: 329
Right 1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067934051 Original CRISPR CTCTGTTTTCGGAGGGAAGC TGG Intronic
No off target data available for this crispr