ID: 1067937675

View in Genome Browser
Species Human (GRCh38)
Location 10:50624846-50624868
Sequence CCCGAGGCCGTGCCTCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067937667_1067937675 7 Left 1067937667 10:50624816-50624838 CCGCGCCGCACCTCGGTGGCCTA 0: 1
1: 0
2: 0
3: 8
4: 54
Right 1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG No data
1067937664_1067937675 12 Left 1067937664 10:50624811-50624833 CCGGCCCGCGCCGCACCTCGGTG 0: 1
1: 0
2: 2
3: 10
4: 144
Right 1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG No data
1067937658_1067937675 26 Left 1067937658 10:50624797-50624819 CCCGCCGTCCCTGGCCGGCCCGC 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG No data
1067937659_1067937675 25 Left 1067937659 10:50624798-50624820 CCGCCGTCCCTGGCCGGCCCGCG 0: 1
1: 0
2: 2
3: 33
4: 327
Right 1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG No data
1067937661_1067937675 18 Left 1067937661 10:50624805-50624827 CCCTGGCCGGCCCGCGCCGCACC 0: 1
1: 0
2: 2
3: 25
4: 302
Right 1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG No data
1067937666_1067937675 8 Left 1067937666 10:50624815-50624837 CCCGCGCCGCACCTCGGTGGCCT 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG No data
1067937662_1067937675 17 Left 1067937662 10:50624806-50624828 CCTGGCCGGCCCGCGCCGCACCT 0: 1
1: 0
2: 3
3: 29
4: 343
Right 1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG No data
1067937660_1067937675 22 Left 1067937660 10:50624801-50624823 CCGTCCCTGGCCGGCCCGCGCCG 0: 1
1: 0
2: 4
3: 29
4: 305
Right 1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG No data
1067937670_1067937675 -3 Left 1067937670 10:50624826-50624848 CCTCGGTGGCCTACAGGCAGCCC 0: 1
1: 0
2: 1
3: 18
4: 160
Right 1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG No data
1067937669_1067937675 2 Left 1067937669 10:50624821-50624843 CCGCACCTCGGTGGCCTACAGGC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067937675 Original CRISPR CCCGAGGCCGTGCCTCCCGC GGG Intronic
No off target data available for this crispr