ID: 1067939060

View in Genome Browser
Species Human (GRCh38)
Location 10:50637320-50637342
Sequence GCAATTTTGTAATGGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067939058_1067939060 -9 Left 1067939058 10:50637306-50637328 CCATGATTACTGCTGCAATTTTG No data
Right 1067939060 10:50637320-50637342 GCAATTTTGTAATGGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067939060 Original CRISPR GCAATTTTGTAATGGAGCCC TGG Intergenic
No off target data available for this crispr