ID: 1067940806

View in Genome Browser
Species Human (GRCh38)
Location 10:50654080-50654102
Sequence CCAGATCCTCCATTTTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067940800_1067940806 10 Left 1067940800 10:50654047-50654069 CCTAATGCCTGAGTGCCTTCCTT No data
Right 1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG No data
1067940803_1067940806 -9 Left 1067940803 10:50654066-50654088 CCTTAATTATCTGCCCAGATCCT No data
Right 1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG No data
1067940799_1067940806 19 Left 1067940799 10:50654038-50654060 CCTGTTTAACCTAATGCCTGAGT No data
Right 1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG No data
1067940801_1067940806 3 Left 1067940801 10:50654054-50654076 CCTGAGTGCCTTCCTTAATTATC No data
Right 1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG No data
1067940802_1067940806 -5 Left 1067940802 10:50654062-50654084 CCTTCCTTAATTATCTGCCCAGA No data
Right 1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067940806 Original CRISPR CCAGATCCTCCATTTTTTTG TGG Intergenic
No off target data available for this crispr