ID: 1067942735

View in Genome Browser
Species Human (GRCh38)
Location 10:50669906-50669928
Sequence CTGGTGCTAAGGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067942735_1067942743 2 Left 1067942735 10:50669906-50669928 CCCTCCTCACTCCTTAGCACCAG No data
Right 1067942743 10:50669931-50669953 CTGGCTGTACATCCCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067942735 Original CRISPR CTGGTGCTAAGGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr