ID: 1067943294

View in Genome Browser
Species Human (GRCh38)
Location 10:50674710-50674732
Sequence CTTTCCTAGCGGGGGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067943294_1067943301 12 Left 1067943294 10:50674710-50674732 CCGCAGGGCCCCCGCTAGGAAAG No data
Right 1067943301 10:50674745-50674767 CCGCCTTTGAGCGCAGCCACAGG No data
1067943294_1067943303 22 Left 1067943294 10:50674710-50674732 CCGCAGGGCCCCCGCTAGGAAAG No data
Right 1067943303 10:50674755-50674777 GCGCAGCCACAGGCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067943294 Original CRISPR CTTTCCTAGCGGGGGCCCTG CGG (reversed) Intergenic
No off target data available for this crispr