ID: 1067945625

View in Genome Browser
Species Human (GRCh38)
Location 10:50686479-50686501
Sequence GAAGGGAATCATAGCTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 5, 1: 2, 2: 0, 3: 11, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067945625_1067945634 30 Left 1067945625 10:50686479-50686501 CCCCCACAGCTATGATTCCCTTC 0: 5
1: 2
2: 0
3: 11
4: 160
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data
1067945625_1067945633 2 Left 1067945625 10:50686479-50686501 CCCCCACAGCTATGATTCCCTTC 0: 5
1: 2
2: 0
3: 11
4: 160
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067945625 Original CRISPR GAAGGGAATCATAGCTGTGG GGG (reversed) Intergenic
902753821 1:18536329-18536351 GAAAGGGATCATAGCAGTGGGGG + Intergenic
904462973 1:30691375-30691397 GAGGTGAATCATATGTGTGGGGG - Intergenic
905942433 1:41874832-41874854 GAAGGGAAAGGTAGCTGGGGAGG - Intronic
906039236 1:42774605-42774627 GAAGTGATTCATTGCTATGGGGG + Intronic
906744204 1:48210360-48210382 GAAGGGAAGAATGACTGTGGTGG + Intergenic
909219838 1:72943079-72943101 GAACTGAATCATAGCTTTAGTGG - Intergenic
910898239 1:92091320-92091342 GCATGGAAGCATAGCTGGGGAGG - Intronic
911201146 1:95044665-95044687 GAAGGTGATCAGTGCTGTGGGGG - Intronic
913116739 1:115704386-115704408 GGAGAGAATGATAGCTGGGGAGG - Intronic
914756022 1:150562044-150562066 GCAGGGAATCACAGATGTGGGGG + Intergenic
915145844 1:153795332-153795354 GGAGGGAATCAAAGCCATGGGGG + Intergenic
917985217 1:180309819-180309841 GATTGCCATCATAGCTGTGGGGG + Intronic
918635033 1:186764916-186764938 TAGGGAAATCATAGCTGGGGCGG + Intergenic
920424550 1:205864179-205864201 GCAAGCAATGATAGCTGTGGCGG + Intergenic
1064499453 10:15953567-15953589 GGGGGGGATCATGGCTGTGGGGG + Intergenic
1065993892 10:31038444-31038466 CAAAGGATTCATAGCTGAGGGGG - Intergenic
1066413849 10:35200653-35200675 GAAGAGAACCACAGCAGTGGTGG + Intronic
1067945625 10:50686479-50686501 GAAGGGAATCATAGCTGTGGGGG - Intergenic
1068363526 10:56012665-56012687 CCAGGGAATCAGAGCTTTGGTGG + Intergenic
1069453056 10:68532635-68532657 GAGGGGAGTCCTAGTTGTGGAGG - Intergenic
1069822598 10:71236824-71236846 GAAGGGAATGATAAATATGGGGG - Intronic
1070867138 10:79713352-79713374 GAAGGGAATCATAGCTGTGGGGG - Intronic
1070880928 10:79851473-79851495 GAAGGGAATCATAGCTGTGGGGG - Intergenic
1071634053 10:87235576-87235598 GAAGGGAATCATAGCTGTGGGGG - Intronic
1071647499 10:87367793-87367815 GAAGGGAATCATAGCTGTGGGGG - Intronic
1075216180 10:120538186-120538208 GAAGGAAATGTTTGCTGTGGAGG - Intronic
1075443368 10:122496656-122496678 GCAGGGAATCTTATCTGAGGGGG + Intronic
1076364525 10:129913592-129913614 TCAGGGAACCATAGCTCTGGGGG - Intronic
1079999623 11:27333014-27333036 GAAAGGAATGACAGCTTTGGGGG - Intronic
1080258063 11:30314989-30315011 GAAGGTAATGATGGCTTTGGTGG - Intergenic
1087291332 11:96323792-96323814 GATGGGAAAGACAGCTGTGGTGG - Intronic
1088842196 11:113636422-113636444 GAAGAATATCATAGCTTTGGTGG - Intergenic
1089377418 11:118004471-118004493 GAAGGGAGACAGAGGTGTGGAGG + Intergenic
1089701363 11:120246010-120246032 TAAGGGAAACAGAGCTGGGGAGG + Intronic
1090400800 11:126447192-126447214 GAAGGGGATGAGAGCCGTGGGGG - Intronic
1090599893 11:128359116-128359138 GAAGGGCATGAGAGCTGTGTGGG - Intergenic
1091590600 12:1840772-1840794 GACGGCAAGCACAGCTGTGGCGG - Exonic
1091759279 12:3076887-3076909 GAAGGGGTTCGTAGGTGTGGGGG + Intergenic
1093021487 12:14208015-14208037 GCAAGGAATCTTAGCTTTGGGGG + Intergenic
1093308439 12:17547610-17547632 GAAGGGAGTCATGGCAGAGGGGG + Intergenic
1095951214 12:47783020-47783042 GGTGGGAATCAGAGCTATGGTGG + Exonic
1096533534 12:52256731-52256753 GAAGGGCTTCCTAGCTGGGGAGG + Intronic
1098769918 12:74539387-74539409 GAAGAGCATCATGGCTGTGCAGG + Exonic
1101249515 12:102918041-102918063 GAATGGCAGCATAGCTGGGGAGG - Intronic
1104416717 12:128601714-128601736 GAAGGGGATCAGTGCAGTGGCGG + Intronic
1106145993 13:27050357-27050379 GAAGGGATTCCAGGCTGTGGAGG - Intergenic
1108021879 13:46136020-46136042 GAAGGAAATCACAGATGTGCTGG - Intronic
1114860645 14:26516473-26516495 GAAAGAAAACATAGCTGTTGGGG - Intronic
1116391770 14:44400312-44400334 GAAGGGCAGCAGAGGTGTGGGGG + Intergenic
1117050263 14:51853369-51853391 GAACAGAACCATAGCAGTGGAGG - Intronic
1119833962 14:77730242-77730264 AAAGGTAATAATTGCTGTGGAGG - Intronic
1121876940 14:97461441-97461463 TAAGGGGATCATCCCTGTGGTGG + Intergenic
1123775187 15:23572766-23572788 TGAGGGAATCACAGTTGTGGGGG + Intronic
1129071248 15:72953232-72953254 GAAGTGAATCATATATGAGGGGG - Intergenic
1131892864 15:96992520-96992542 CAAGGGAATCAGTGCTGGGGTGG - Intergenic
1135553828 16:23419084-23419106 GAAGGGATTCTTATTTGTGGTGG - Intronic
1137611507 16:49821334-49821356 GAAGAGAACCAGAGCTGGGGAGG + Intronic
1137819206 16:51427495-51427517 GGAGAGAATCATAGTTGTGGAGG + Intergenic
1141721155 16:85756059-85756081 TAAGGGAGGCAGAGCTGTGGGGG - Intergenic
1143065584 17:4244670-4244692 GATGGGAATCATTGCTGGGATGG - Intronic
1143675510 17:8429626-8429648 GAAGGGAATCATCTATTTGGGGG + Intronic
1149600714 17:57891431-57891453 GGAGGGTATGGTAGCTGTGGAGG - Intronic
1149775195 17:59351744-59351766 GAAGGGATTCAGACCTTTGGGGG - Intronic
1153954102 18:10081389-10081411 GAAGTAAGACATAGCTGTGGTGG + Intergenic
1155558359 18:27047339-27047361 GAAGGTAATCATACCTGTGAGGG + Intronic
1155754122 18:29468614-29468636 GAAGAGAATCTTGGTTGTGGAGG - Intergenic
1163708985 19:18834043-18834065 GAAGGGAGTCTGAGCTGCGGAGG + Intronic
1164616084 19:29667536-29667558 CAAGGGAATCAGAGTTCTGGGGG - Intronic
1165348944 19:35266449-35266471 CATGGGAATCATAGCTGGTGGGG - Exonic
1165890913 19:39111795-39111817 GGAGGGAATGAAATCTGTGGAGG - Intergenic
1166555231 19:43695111-43695133 GAAGGGGGCCACAGCTGTGGAGG - Intergenic
926001657 2:9338444-9338466 GAAGAAAATTATGGCTGTGGTGG - Intronic
932436242 2:71704008-71704030 GAAGGCAAACACAGCTGTGGGGG - Intergenic
933615952 2:84482767-84482789 GAAGGCAATCATAGTTCTGAAGG + Intergenic
934126354 2:88896403-88896425 AAAGGGAATCATGGAGGTGGAGG - Intergenic
934963495 2:98698957-98698979 TAAGGAACTCATAGCTGAGGAGG - Intronic
936988124 2:118331255-118331277 GAAGGGAAGCAGAGCGGTAGGGG + Intergenic
937127485 2:119483776-119483798 GAAGGAAATCATAGCACAGGAGG + Intronic
937315583 2:120930221-120930243 GAAGGCAGTCATCGCTGTTGGGG - Intronic
942072052 2:172324897-172324919 ACAGGGTATCATAGCTCTGGGGG + Intergenic
945637652 2:212376512-212376534 GAGCAGAAGCATAGCTGTGGTGG - Intronic
946640267 2:221776267-221776289 AGTGGGAATCACAGCTGTGGTGG + Intergenic
947540633 2:230975153-230975175 CAAGGGACTCATGGCTGTAGGGG - Intergenic
948709884 2:239819019-239819041 GAAGGGAATCAAGGATGGGGAGG - Intergenic
1170738547 20:19032277-19032299 GATGGCAGTCATAGCAGTGGTGG + Intergenic
1173340918 20:42152031-42152053 CAAGGGAATCACAGCTCTGCAGG + Intronic
1179025334 21:37674716-37674738 GAAAGGAATCACGGCTCTGGAGG - Intronic
1184142311 22:42585051-42585073 GAAGGGAAAGAGAGCTGGGGTGG + Exonic
1184217906 22:43079494-43079516 TCAGGAAATCACAGCTGTGGAGG - Intronic
1184829837 22:46977680-46977702 TACAGGAATCATAGCTGAGGAGG + Intronic
949790619 3:7788015-7788037 GATAAGAATCTTAGCTGTGGTGG - Intergenic
954671130 3:52291914-52291936 GAAGGGACTCATACCTGGGCAGG - Exonic
955531396 3:59876578-59876600 GAGGGGACTCATACCTTTGGTGG + Intronic
956371860 3:68571487-68571509 GCAGGCATTCATAGCAGTGGTGG - Intergenic
957367584 3:79246316-79246338 GAAGGGAAACTTAGATGTTGTGG + Intronic
957845957 3:85735646-85735668 GATGAGAATCATAGCACTGGAGG + Intronic
958954909 3:100456876-100456898 GAAGGGCATCCTAGCTTTGAGGG + Intergenic
959208152 3:103340055-103340077 GAATCAAATCATAACTGTGGAGG - Intergenic
959538329 3:107512380-107512402 GAAGGGAAGCCTAGATGGGGTGG + Intergenic
962040746 3:131705162-131705184 GTTTGGAATCATTGCTGTGGAGG + Intronic
962390803 3:134971040-134971062 GAAGTGACTCATAGATGAGGTGG + Intronic
965140217 3:164823340-164823362 GAAGAGTAACATAGCTGTGAAGG - Intergenic
965320337 3:167245767-167245789 CACGGGAAGCATGGCTGTGGAGG - Intronic
972817848 4:42663943-42663965 GAAATGAATCATAGTTGTGAGGG - Intergenic
979162156 4:117475465-117475487 GAATGTAGGCATAGCTGTGGAGG - Intergenic
980297638 4:130942881-130942903 GAAGGCAATCCTAGCTGTAATGG - Intergenic
980327124 4:131361006-131361028 TAAAGGAATCATGGCTGGGGAGG + Intergenic
980877120 4:138672759-138672781 GAAGGAAAGCAGAGCTGTGAGGG + Intergenic
981409305 4:144409991-144410013 GAAGGGAATAATAAGTGAGGGGG + Intergenic
982234069 4:153235904-153235926 GAAGGTAATCATAGTTTAGGTGG - Intronic
983274597 4:165602167-165602189 GGAGGGAATCAGAGCAGAGGAGG + Intergenic
984805138 4:183745276-183745298 GAAAGATCTCATAGCTGTGGAGG - Intergenic
984950399 4:185003736-185003758 GAAGGGAGTCTTGGCTGAGGAGG - Intergenic
985919626 5:2959812-2959834 GAAGGGAGTGAGAGCTGTGGTGG + Intergenic
987491970 5:18593268-18593290 TAGGGGAAGCATAGCTGGGGAGG + Intergenic
989179605 5:38563356-38563378 AAAGAGAAACATAGCTGTGCAGG + Intronic
989343970 5:40408480-40408502 CAAGGCAGTCAGAGCTGTGGCGG - Intergenic
990856846 5:60277868-60277890 TAAGGGAATTATAAGTGTGGAGG - Intronic
995332919 5:110965720-110965742 GAAGGAAGGCATAGCTGTGAGGG - Intergenic
995955157 5:117768891-117768913 TACAGGAATCACAGCTGTGGAGG - Intergenic
998301355 5:141024293-141024315 GTAGGGAGTCAGGGCTGTGGAGG + Intergenic
999511552 5:152257664-152257686 GAAGGTGATCATAGTGGTGGTGG + Intergenic
999931917 5:156442907-156442929 GAAGGAAACCGTAGCTGTGATGG + Intronic
1000414120 5:160965433-160965455 TACAGGAATCATAGCTGGGGAGG - Intergenic
1001443239 5:171762383-171762405 AAAGGGATTCATAGCCCTGGGGG - Intergenic
1001525440 5:172425433-172425455 GAAGGGAAGCCTATCTGAGGAGG + Intronic
1001716539 5:173821023-173821045 GAAGGGAAACTGAGGTGTGGAGG - Intergenic
1003177947 6:3767334-3767356 GGAGGGAAGCAAAGGTGTGGGGG + Intergenic
1005372785 6:25153019-25153041 GAAGGGGTTCATGGCAGTGGAGG + Intergenic
1006194089 6:32227252-32227274 GAAGGGAACCAGAAGTGTGGTGG + Intergenic
1006873515 6:37275390-37275412 GGGGAGAATTATAGCTGTGGTGG + Intronic
1009025070 6:57989565-57989587 GAAGGATATCATGGCTGGGGTGG - Intergenic
1010363958 6:75028298-75028320 GAAGGGAAGCTTAGCAGTGGAGG + Intergenic
1010768453 6:79802258-79802280 GAAGGGAGAAATAGCTTTGGAGG - Intergenic
1014698971 6:124659697-124659719 GAAAGTAATAATAGCTGTGGAGG + Intronic
1015591809 6:134829608-134829630 GAAGGGAATCATGTCTGGAGGGG + Intergenic
1017156547 6:151327479-151327501 GTAGGGAGTCACAGCTGGGGTGG + Intronic
1019638050 7:2087153-2087175 GAACTGAATCATGGCTGTGGTGG + Intronic
1021035520 7:15793801-15793823 GAAGGGTAGCATAGGGGTGGAGG + Intergenic
1021040995 7:15862179-15862201 GCAGAGAATCATGGCTCTGGTGG + Intergenic
1021093339 7:16508504-16508526 GCTGGGAAGCATAGTTGTGGGGG + Intronic
1021182624 7:17525545-17525567 GTTGGGTATCATGGCTGTGGGGG - Intergenic
1021596030 7:22317973-22317995 GAAAGGAATCATACCTGGGAAGG + Exonic
1022627727 7:32055246-32055268 GTAGGAAACCACAGCTGTGGTGG - Intronic
1023870826 7:44262235-44262257 TAAGTGAATCAGAGCTTTGGAGG + Intronic
1024231592 7:47367671-47367693 GAGGGGACTGAGAGCTGTGGTGG - Intronic
1026401083 7:70013568-70013590 GAAGGTGGACATAGCTGTGGGGG + Intronic
1026969295 7:74458258-74458280 GAAGGAATTCATAGCAGAGGTGG + Intronic
1030478706 7:110074149-110074171 GAAGGGAATAATAGACATGGGGG - Intergenic
1034026874 7:147714381-147714403 CAAGGGAAGTATAGTTGTGGAGG + Intronic
1034046713 7:147937056-147937078 GAAGGGAATCGTGGTGGTGGTGG - Intronic
1037096633 8:14994028-14994050 GATGCGAGTCATGGCTGTGGAGG + Intronic
1037701878 8:21282899-21282921 GAAGGGATTCATTGCCTTGGGGG + Intergenic
1041301042 8:56411629-56411651 AAATGGAATCAGAGCTGTGATGG - Intergenic
1042187260 8:66149139-66149161 GGAGGGAATCCTAGCTGCAGAGG + Intronic
1044994593 8:97827439-97827461 GAAGAGATTCATAGATATGGGGG - Intronic
1048340193 8:133532884-133532906 GACGAGAAGCATAGCTTTGGAGG + Intronic
1050289102 9:4135318-4135340 TAAGGGAATGATAGATGTCGGGG - Intronic
1053099115 9:35354470-35354492 AAAGGGAATAAGACCTGTGGAGG - Intronic
1054930178 9:70627713-70627735 GAAGGGCATCATATATGAGGTGG + Intronic
1055052890 9:71997304-71997326 AGAGGGAATCATAGCTCAGGGGG + Intergenic
1055243664 9:74216426-74216448 CAATGCAATCATAGTTGTGGTGG - Intergenic
1057095603 9:92305585-92305607 GAAAGGAATTATTGATGTGGTGG - Intronic
1057353305 9:94317585-94317607 GAAGGGAATCATAGCTGTTGGGG + Intergenic
1057654446 9:96940007-96940029 GAAGGGAATCATAGCTGTTGGGG - Intronic
1058155131 9:101506348-101506370 AAAGGAAATGTTAGCTGTGGAGG + Intronic
1060438993 9:123620718-123620740 GAAGGGAAGCTGGGCTGTGGTGG - Intronic
1062481044 9:136751906-136751928 TACAGGAATCACAGCTGTGGAGG + Intergenic
1203775080 EBV:68417-68439 GTCTGGCATCATAGCTGTGGTGG + Intergenic
1185669509 X:1794947-1794969 GAAGGGCATCGTGGCAGTGGGGG - Intergenic
1186457855 X:9724482-9724504 GAGCGGAAGCATTGCTGTGGTGG - Intergenic
1187521725 X:20020212-20020234 GGAGGGACACATAGCTGTGGAGG - Intronic
1187768454 X:22669015-22669037 CAACAGAATCATAGTTGTGGTGG + Intergenic
1188672996 X:32903363-32903385 GAAGGGAATTACAGCAGAGGAGG + Intronic
1189355048 X:40304288-40304310 GAAGGGAAGCAGAGCTGTAGAGG + Intergenic
1196063558 X:111437870-111437892 GAAGGGAATCATAACACTAGGGG - Intergenic
1196581332 X:117382619-117382641 AAAGGAAATGATATCTGTGGTGG - Intergenic
1200342728 X:155416135-155416157 GAAGAGAGACATAGCTCTGGGGG - Intergenic