ID: 1067945626

View in Genome Browser
Species Human (GRCh38)
Location 10:50686480-50686502
Sequence GGAAGGGAATCATAGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 5, 1: 2, 2: 2, 3: 11, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067945626_1067945634 29 Left 1067945626 10:50686480-50686502 CCCCACAGCTATGATTCCCTTCC 0: 5
1: 2
2: 2
3: 11
4: 202
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data
1067945626_1067945633 1 Left 1067945626 10:50686480-50686502 CCCCACAGCTATGATTCCCTTCC 0: 5
1: 2
2: 2
3: 11
4: 202
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067945626 Original CRISPR GGAAGGGAATCATAGCTGTG GGG (reversed) Intergenic
900251073 1:1669999-1670021 GGAAGGGAGTCAGGCCTGTGGGG + Intronic
900675863 1:3885805-3885827 GGAAGGGCCTCACAGCTGTCCGG - Intergenic
902202822 1:14846395-14846417 GGAAGGGAACCATAACAGAGAGG + Intronic
902753820 1:18536328-18536350 GGAAAGGGATCATAGCAGTGGGG + Intergenic
903456517 1:23491017-23491039 GGAAGAAAATCAAAGCAGTGTGG - Intergenic
903634524 1:24801672-24801694 GGAATGGAATTATAGCTCTCAGG - Intronic
904339666 1:29826627-29826649 GGGAGGGATGAATAGCTGTGGGG - Intergenic
905563833 1:38947732-38947754 GGGATGCAATCATAACTGTGTGG - Intergenic
906111156 1:43322951-43322973 GGATGGGAAACACACCTGTGGGG - Exonic
907731640 1:57072303-57072325 GGAAGGGAATCACAGATTTGTGG - Exonic
909185621 1:72481929-72481951 GGAAAGGGAACAGAGCTGTGAGG + Intergenic
910136595 1:83979270-83979292 GGGATGAAATCATAGCGGTGTGG + Intronic
912483756 1:110007229-110007251 GGGAAGGAATCATAGCAGAGGGG + Intronic
912797183 1:112700418-112700440 GGGAGGTAGTCATGGCTGTGGGG - Exonic
912863739 1:113237901-113237923 GGGATGGAATCATTCCTGTGAGG - Intergenic
914756021 1:150562043-150562065 AGCAGGGAATCACAGATGTGGGG + Intergenic
914783088 1:150803500-150803522 GGAAGGAAATCATATCTGAAAGG - Intronic
915145843 1:153795331-153795353 GGGAGGGAATCAAAGCCATGGGG + Intergenic
916335843 1:163670452-163670474 GGAATGGAAGCCCAGCTGTGTGG + Intergenic
916945284 1:169720110-169720132 GGGATGCAATCATAGCGGTGTGG - Intronic
917124059 1:171670464-171670486 GGAAGGGATACAAAGCTGTGGGG + Intergenic
917443790 1:175089514-175089536 GAATGGGAAGCATAGCTGTCAGG - Intronic
921403235 1:214749677-214749699 GGGAGGAAAACACAGCTGTGTGG - Intergenic
921573541 1:216806936-216806958 GTAAAGGAATCCTATCTGTGAGG + Intronic
922926866 1:229355352-229355374 TGAAGGCAATGCTAGCTGTGGGG + Intergenic
923250833 1:232178430-232178452 GGAATGCAATCATAGGGGTGTGG - Intergenic
923908189 1:238409367-238409389 GGAATGAAATCATAGAGGTGTGG - Intergenic
1063096670 10:2915013-2915035 GGAAAGGAAGCATGGCTGTTGGG + Intergenic
1063606271 10:7525818-7525840 GCAAGGAAATCAGAGATGTGAGG + Intergenic
1063952650 10:11238150-11238172 AGAAAGGAATCATGGCTGAGAGG + Intronic
1065773769 10:29101163-29101185 GGCAGGGTATCGGAGCTGTGAGG + Intergenic
1065893113 10:30137900-30137922 GCAAGGGGATCTTGGCTGTGAGG - Intergenic
1066403009 10:35093112-35093134 GGGATGGAATCATAGGGGTGTGG - Intergenic
1067945626 10:50686480-50686502 GGAAGGGAATCATAGCTGTGGGG - Intergenic
1068128114 10:52866291-52866313 GGAAGTGAATCATTTCTGTATGG + Intergenic
1069794637 10:71044219-71044241 GGCAGGGGATCACAGCTGCGTGG + Intergenic
1070867139 10:79713353-79713375 GGAAGGGAATCATAGCTGTGGGG - Intronic
1070880929 10:79851474-79851496 GGAAGGGAATCATAGCTGTGGGG - Intergenic
1071634054 10:87235577-87235599 GGAAGGGAATCATAGCTGTGGGG - Intronic
1071647500 10:87367794-87367816 GGAAGGGAATCATAGCTGTGGGG - Intronic
1071713429 10:88072023-88072045 GGAAGTGCTTCACAGCTGTGTGG - Intergenic
1072737098 10:97886459-97886481 GGAAGAGAAACTGAGCTGTGTGG - Intronic
1072770386 10:98132934-98132956 GGAATGAAATCATAGGGGTGTGG + Intergenic
1072887942 10:99296910-99296932 GGAAGGCAATCATCGATGGGAGG + Intergenic
1073555621 10:104447978-104448000 GGAAGAGAAGGATAGCTCTGAGG - Intronic
1075443367 10:122496655-122496677 GGCAGGGAATCTTATCTGAGGGG + Intronic
1076048336 10:127312793-127312815 GGGAGGGAGTGATGGCTGTGAGG - Intronic
1077580869 11:3416493-3416515 GGAAGGGTATCTGGGCTGTGAGG + Intergenic
1077922806 11:6654655-6654677 GGAAGTGTATGATGGCTGTGAGG + Intronic
1079883317 11:25953818-25953840 GGAAGGAAATCATATCTATTTGG + Intergenic
1082652615 11:55812198-55812220 GGAAGACAGTGATAGCTGTGAGG - Exonic
1083956151 11:65983967-65983989 GCAAAGGAATCATCACTGTGGGG - Intergenic
1084046378 11:66570409-66570431 GGAATGAAATCATAGTAGTGTGG - Intergenic
1084237796 11:67799327-67799349 GGAAGGGTATCTGGGCTGTGAGG + Intergenic
1084834612 11:71793506-71793528 GGAAGGGTATCTGGGCTGTGAGG - Intronic
1090400801 11:126447193-126447215 GGAAGGGGATGAGAGCCGTGGGG - Intronic
1090599894 11:128359117-128359139 GGAAGGGCATGAGAGCTGTGTGG - Intergenic
1091160916 11:133418997-133419019 GGAATGAAATCATAGGTGTGTGG - Intronic
1091299356 11:134497718-134497740 AGAAGGAAACCATAGCTGAGTGG + Intergenic
1091759278 12:3076886-3076908 GGAAGGGGTTCGTAGGTGTGGGG + Intergenic
1092408469 12:8236924-8236946 GGAAGGGTATCTGGGCTGTGAGG + Intergenic
1093104853 12:15074065-15074087 GGGAGGGACTCAGAGCTTTGTGG - Intergenic
1094541214 12:31364584-31364606 GGAAGGTTATCACTGCTGTGGGG + Intergenic
1100323848 12:93522642-93522664 AGAAGGAAATTGTAGCTGTGAGG + Intergenic
1100456639 12:94758014-94758036 TGAAGGGAGTAAGAGCTGTGGGG + Intergenic
1105464607 13:20626604-20626626 GGAAGGGTCTCATGGCTGTATGG + Intronic
1106412961 13:29523877-29523899 AGAATGGGATCATAGCTGTGTGG - Intronic
1106609350 13:31263712-31263734 GGAAGGGAATCATGGACCTGTGG - Intronic
1114860646 14:26516474-26516496 GGAAAGAAAACATAGCTGTTGGG - Intronic
1115282948 14:31685267-31685289 GCAAGGGAATAATAGATGTTCGG + Intronic
1115938007 14:38576959-38576981 TGAAGGAAATAAGAGCTGTGAGG - Intergenic
1116391769 14:44400311-44400333 GGAAGGGCAGCAGAGGTGTGGGG + Intergenic
1116588899 14:46745853-46745875 AGAAGAGATTCAAAGCTGTGTGG + Intergenic
1117725720 14:58671469-58671491 TGAAGGTAATCATAACTGTTAGG - Intergenic
1118990104 14:70790228-70790250 GAAAGGGAATCTTTGCTGAGTGG - Intronic
1120219873 14:81719844-81719866 GGAATGGAAGCATAGCTCAGTGG + Intergenic
1121686487 14:95839108-95839130 GGAAGGGCATGATATCTTTGTGG + Intergenic
1122947052 14:105016581-105016603 GGAAGGAACGCTTAGCTGTGGGG - Intronic
1127335874 15:57983350-57983372 GGAAAGGAATGCTAGCTGTGAGG - Intronic
1129933465 15:79431238-79431260 GGGAGGGAATCATAGTTTCGGGG - Intergenic
1130894692 15:88160800-88160822 GGAAGGGAACAGTGGCTGTGTGG + Intronic
1131302448 15:91211318-91211340 AGAAGGGGATCATGGGTGTGTGG + Intronic
1132359445 15:101200682-101200704 TGAAGAGAATCATAGCTGAGAGG - Intronic
1133349431 16:5091747-5091769 GGAAGGGTATCTGGGCTGTGAGG + Intronic
1133455905 16:5942306-5942328 GAAATGTAATCATAGGTGTGTGG + Intergenic
1133642624 16:7732425-7732447 GGAAGGGAAACATAGCTGTTTGG - Intergenic
1134780101 16:16887701-16887723 GGAAGGGAACCTTTGCTGGGCGG + Intergenic
1138676456 16:58655018-58655040 GGAATGGAATCTTAGCTTAGAGG - Intergenic
1141013958 16:80430009-80430031 GGAAGGGACTGATAACTGGGGGG - Intergenic
1143675509 17:8429625-8429647 GGAAGGGAATCATCTATTTGGGG + Intronic
1149098618 17:52875522-52875544 GGGAAGGAATCATAGCTTTTAGG - Intronic
1154490031 18:14914542-14914564 GGAAGGGTATGATGGCTGTTTGG + Intergenic
1154972186 18:21421116-21421138 GCAAGGGAAGCATAGGTGGGAGG + Intronic
1155347150 18:24868789-24868811 GGAGGGGCATCTGAGCTGTGAGG + Intergenic
1155558358 18:27047338-27047360 TGAAGGTAATCATACCTGTGAGG + Intronic
1156192826 18:34739495-34739517 GGAAGCAAATCATTGCTCTGTGG - Intronic
1156647241 18:39179859-39179881 GGAAGGGACTCACAGCAGTCAGG + Intergenic
1158165366 18:54533717-54533739 GGGATGGAATCATAGGAGTGTGG + Intergenic
1158228260 18:55223392-55223414 AGAAGAGAATCATAGCTATATGG + Intronic
1159348004 18:67232017-67232039 GGAGGGGAAACATAACTTTGGGG - Intergenic
1159405967 18:68003456-68003478 GGAAGGGAATCATTCCTGCTGGG + Intergenic
1159775660 18:72600824-72600846 GGAATGAAATCATAGGGGTGTGG + Intronic
1160340218 18:78083118-78083140 GAAAGGGAGTCACAGCTGAGAGG - Intergenic
1162658398 19:12150257-12150279 GGAAGGGAATCAGAAATGTAAGG + Intronic
1162919092 19:13889868-13889890 GGAAGGGACTCATAGCAGCCTGG - Exonic
1167366581 19:49057810-49057832 AGAAGGAAATCACAGCTTTGGGG - Exonic
1167810626 19:51826803-51826825 GGAAGGCAATCATAGGAGAGTGG + Intergenic
1168579195 19:57539566-57539588 GGAAGGAGAGCAGAGCTGTGTGG + Exonic
925291771 2:2752621-2752643 GAAAGGGAACCCTTGCTGTGGGG + Intergenic
927011894 2:18912441-18912463 AGAAGGGAGTCAAAGGTGTGAGG - Intergenic
930544000 2:52744551-52744573 GTAATTGAATCATAGCAGTGGGG + Intergenic
932071718 2:68627298-68627320 GGAACTGATTCAGAGCTGTGGGG - Intronic
932436243 2:71704009-71704031 AGAAGGCAAACACAGCTGTGGGG - Intergenic
932583572 2:73008371-73008393 GGGAGGGAAGCAGTGCTGTGGGG + Intronic
934062991 2:88313421-88313443 GGGTGGGAAGCATAGCTTTGTGG + Intergenic
936988123 2:118331254-118331276 GGAAGGGAAGCAGAGCGGTAGGG + Intergenic
937315584 2:120930222-120930244 GGAAGGCAGTCATCGCTGTTGGG - Intronic
937505916 2:122536240-122536262 GGAAGGGAATTATGGGTGAGAGG - Intergenic
1169892922 20:10473119-10473141 GGAAGAAAAAAATAGCTGTGGGG + Intronic
1173895101 20:46545282-46545304 GGAAGGGAGTCATTGTTTTGAGG - Intronic
1174267654 20:49343616-49343638 GGCAGGGAATGCTGGCTGTGGGG - Intergenic
1178849519 21:36201305-36201327 GGAATAGAATCCCAGCTGTGGGG - Intronic
1180799190 22:18623896-18623918 GAAAGGGAGTCCCAGCTGTGTGG - Intergenic
1181222528 22:21371370-21371392 GAAAGGGAGTCCCAGCTGTGTGG + Intergenic
1181445899 22:22973992-22974014 GGAAAGGAATCAGAGCTTTCTGG - Intergenic
1185394414 22:50579389-50579411 GGATGGGAATGCTAGCTGGGGGG - Intronic
950858342 3:16126116-16126138 GGAAGGGAAAGAGAGATGTGTGG - Intergenic
951908209 3:27723596-27723618 CGCAGGGAATCCTAACTGTGGGG - Intergenic
953275128 3:41488293-41488315 GGATGGGAATAATAACTGAGTGG - Intronic
954297464 3:49682200-49682222 GGAAGGGACTCAGAGATTTGAGG - Intronic
955054253 3:55442074-55442096 GGAAGGGCAACTTTGCTGTGTGG - Intergenic
955874208 3:63473220-63473242 GGAAGGGGGACATAGCTGTCTGG - Intronic
958713065 3:97741553-97741575 GGATGGGAATAATAACAGTGAGG - Intronic
958795468 3:98702441-98702463 GGAAGGAACTCATTGCTGGGAGG - Intergenic
958825610 3:99026704-99026726 GGAAGGGAAAAATATCTCTGAGG + Intergenic
958954908 3:100456875-100456897 AGAAGGGCATCCTAGCTTTGAGG + Intergenic
959830735 3:110858784-110858806 GGAAGGGAATCACAGTTCAGAGG + Intergenic
960426139 3:117510000-117510022 GGGATGAAATCATAGGTGTGTGG + Intergenic
961301106 3:125922590-125922612 GGAAGGGTATCTGGGCTGTGAGG - Intergenic
961520654 3:127465776-127465798 GGAAGGAAACCAGTGCTGTGCGG + Intergenic
961667091 3:128499197-128499219 GGAAGGGACTCAGAGGTGTCAGG + Intergenic
961887419 3:130105483-130105505 GGAAGGGTATCTGGGCTGTGAGG + Intronic
962677824 3:137769446-137769468 GGAAGGGAATCAAAGATTTTTGG - Intergenic
963878602 3:150503543-150503565 GGGTGGGAAGCACAGCTGTGGGG - Intergenic
967024894 3:185556177-185556199 GAAAGGGAATCATTTCTGTTGGG + Intergenic
968996543 4:3949401-3949423 GGAAGGGTATCTGGGCTGTGAGG + Intergenic
969185576 4:5471818-5471840 GCAAGGGAGTCAGAGCTGGGAGG - Intronic
969757457 4:9159281-9159303 GGAAGGGTATCTGGGCTGTGAGG - Intergenic
969817417 4:9696817-9696839 GGAAGGGTATCTGGGCTGTGAGG - Intergenic
971607787 4:28680804-28680826 GGAATGGAAACAGAGTTGTGAGG - Intergenic
971642858 4:29157915-29157937 GGAATGGGATCATAGTGGTGTGG + Intergenic
972817849 4:42663944-42663966 AGAAATGAATCATAGTTGTGAGG - Intergenic
974083312 4:57234465-57234487 GGATGGGAATGACAGGTGTGCGG + Intergenic
975204656 4:71630918-71630940 GGAATGAAATCATAGAGGTGTGG + Intergenic
975343093 4:73263097-73263119 GGCATGGAAATATAGCTGTGTGG - Intergenic
975735951 4:77381301-77381323 GGAAGGGACTAATAGATTTGAGG - Intronic
978737382 4:112099283-112099305 GGGAGGAAATCATAGTTGAGAGG + Intergenic
980877119 4:138672758-138672780 AGAAGGAAAGCAGAGCTGTGAGG + Intergenic
981695843 4:147558015-147558037 GGAAAGGAATCAATGCTCTGGGG - Intergenic
983852716 4:172602278-172602300 GATAGGGAATCGTAGCTATGTGG + Intronic
986345636 5:6832760-6832782 GGATAGGAATCAAAACTGTGTGG - Intergenic
986586378 5:9322292-9322314 GGAAGGGCACCATAGCTCTCAGG - Intronic
991667234 5:69011415-69011437 GGAGGGGCATCATCCCTGTGAGG + Intergenic
995332920 5:110965721-110965743 TGAAGGAAGGCATAGCTGTGAGG - Intergenic
997363785 5:133312379-133312401 GTAATTGAAGCATAGCTGTGAGG - Intronic
998229906 5:140354393-140354415 GGAAGGGCACCCTAGCTCTGGGG + Intergenic
998670719 5:144349911-144349933 GGAAGGGATTGGCAGCTGTGTGG - Intronic
999631818 5:153579172-153579194 GGAAAGGAGTCAGAGCTTTGGGG - Intronic
1001330346 5:170757922-170757944 AGCAGGGAATCCTGGCTGTGAGG + Intergenic
1001443240 5:171762384-171762406 GAAAGGGATTCATAGCCCTGGGG - Intergenic
1005791325 6:29304555-29304577 GGAAGGGAATCATATACGTGTGG - Intergenic
1006355647 6:33555720-33555742 GGAAGGGAGGCATATCTGAGAGG + Intergenic
1006389357 6:33749456-33749478 GGAAGGGAAGCTGAGCTTTGGGG - Intergenic
1010133315 6:72521615-72521637 GAATGGGAATCATATCTGCGGGG - Intergenic
1011022816 6:82833233-82833255 GGGATGCAATCATAGCAGTGTGG + Intergenic
1011459591 6:87589649-87589671 GTAAAGCATTCATAGCTGTGGGG + Intronic
1013857597 6:114592690-114592712 GGAAGTGAATCATCTCTGTTAGG + Intergenic
1015199642 6:130564936-130564958 TTAAAGGAATCATAGCAGTGTGG - Intergenic
1015234956 6:130960148-130960170 GGAAGGTATACACAGCTGTGTGG - Intronic
1018990202 6:168668815-168668837 GGAGGGGAATGCTAGGTGTGTGG - Intronic
1019863538 7:3683614-3683636 CGCAGGGAATGTTAGCTGTGAGG - Intronic
1020320824 7:6937816-6937838 GGAAGGGTATCTGGGCTGTGAGG + Intergenic
1020450921 7:8319682-8319704 GGGATGCAATCATAGGTGTGTGG + Intergenic
1020654355 7:10911844-10911866 GGAATGAAATCATAGGGGTGTGG - Intergenic
1021093338 7:16508503-16508525 GGCTGGGAAGCATAGTTGTGGGG + Intronic
1026401082 7:70013567-70013589 GGAAGGTGGACATAGCTGTGGGG + Intronic
1029942813 7:104497951-104497973 GGAGGGGAACCCTAGGTGTGGGG + Intronic
1033620200 7:143055492-143055514 GTAAGGGAAACATGGCTGAGAGG + Intergenic
1036380700 8:8234609-8234631 GGAAGGGTATCTGGGCTGTGAGG - Intergenic
1036443775 8:8804104-8804126 GAAAAGGAATGATATCTGTGGGG - Intronic
1036848874 8:12188025-12188047 GGAAGGGTATCTGGGCTGTGAGG + Intronic
1036870235 8:12430303-12430325 GGAAGGGTATCTGGGCTGTGAGG + Intronic
1039727360 8:40233192-40233214 GGAATGCAATCATAGGGGTGTGG - Intergenic
1040561685 8:48528306-48528328 GGAAGGGATTCAAAGCCTTGGGG + Intergenic
1041524012 8:58785709-58785731 TGATGCGAATCAGAGCTGTGGGG + Intergenic
1042241722 8:66670735-66670757 GGAAGGGAATCATAACTTTGGGG + Intronic
1043414677 8:80034419-80034441 GCAAGGGAAGCATGGCTGGGGGG - Intronic
1043562957 8:81516392-81516414 TTAAGGGAATCATGGCTGTTGGG - Intergenic
1043944860 8:86238334-86238356 GGAATGCAATCATAGGGGTGTGG - Intronic
1046215115 8:111135077-111135099 GGCTGGGAAGCATAGCTGGGGGG - Intergenic
1050473788 9:6020005-6020027 TGAAGGGTATCATATCTGTCAGG + Intergenic
1052789981 9:32866273-32866295 GGAAAGGAATCATCGGTGAGTGG + Intergenic
1052842612 9:33305887-33305909 GGATGAGAATCACAGCTGAGAGG + Intronic
1055332589 9:75199229-75199251 GGAATGCAATCATAGGGGTGTGG + Intergenic
1055813810 9:80181835-80181857 GGAATGCAATCATAGGGGTGTGG - Intergenic
1056217846 9:84421849-84421871 GGAATGCAATCATAGGGGTGTGG + Intergenic
1057189024 9:93075925-93075947 GGAAGGGGAGCATCGCTGAGTGG + Exonic
1057353304 9:94317584-94317606 GGAAGGGAATCATAGCTGTTGGG + Intergenic
1057654447 9:96940008-96940030 GGAAGGGAATCATAGCTGTTGGG - Intronic
1057909035 9:99004059-99004081 AGAAGGGCAGCATACCTGTGGGG + Intronic
1059143292 9:111874592-111874614 GGAAGGGAAACAAAGCTCTATGG + Intergenic
1060873146 9:127058932-127058954 GGCAGGAAATCATAGCTGATGGG + Intronic
1061912886 9:133734207-133734229 GGGAGAGAATCAGAGCTGGGTGG + Intronic
1186712295 X:12212059-12212081 GGAAGGGAAGGATGGCTGTGGGG - Intronic
1189104812 X:38224315-38224337 GGAATGGTGTCATAGCTCTGTGG - Intronic
1189561511 X:42195772-42195794 GCAAGGGAATCTGAGATGTGAGG + Intergenic
1192783919 X:74319816-74319838 GGAATGCAATCATAGAGGTGTGG + Intergenic
1193849847 X:86523647-86523669 GGAATGAAATCATAGGGGTGTGG + Intronic
1195484914 X:105393207-105393229 GGAATGCAATCATAGGAGTGTGG + Intronic
1198153643 X:133935357-133935379 GGAAAGGAATAATAAGTGTGTGG + Intronic
1200342729 X:155416136-155416158 GGAAGAGAGACATAGCTCTGGGG - Intergenic
1201078656 Y:10209956-10209978 GGAAGGGAAACATCACTCTGGGG + Intergenic