ID: 1067945627

View in Genome Browser
Species Human (GRCh38)
Location 10:50686481-50686503
Sequence GGGAAGGGAATCATAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 7, 1: 0, 2: 2, 3: 19, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067945627_1067945633 0 Left 1067945627 10:50686481-50686503 CCCACAGCTATGATTCCCTTCCC 0: 7
1: 0
2: 2
3: 19
4: 168
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data
1067945627_1067945634 28 Left 1067945627 10:50686481-50686503 CCCACAGCTATGATTCCCTTCCC 0: 7
1: 0
2: 2
3: 19
4: 168
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067945627 Original CRISPR GGGAAGGGAATCATAGCTGT GGG (reversed) Intergenic
902136820 1:14313880-14313902 GGGTTGGGAATCATAAATGTAGG + Intergenic
902753819 1:18536327-18536349 GGGAAAGGGATCATAGCAGTGGG + Intergenic
906111157 1:43322952-43322974 GGGATGGGAAACACACCTGTGGG - Exonic
907291205 1:53414055-53414077 GGGAAGGGCATGACAGCTGGAGG - Intergenic
908143269 1:61210143-61210165 GGGAAGGGTATAATACCTTTGGG + Intronic
909595489 1:77401779-77401801 GGAAAGGGAATTATAGCAGAGGG - Intronic
910704197 1:90109412-90109434 AGGAAGGGAAAGATAACTGTTGG + Intergenic
912483755 1:110007228-110007250 GGGGAAGGAATCATAGCAGAGGG + Intronic
912597843 1:110897144-110897166 GGGAAATGAATCATAGGTGAAGG + Intronic
912797184 1:112700419-112700441 GGGGAGGTAGTCATGGCTGTGGG - Exonic
917124058 1:171670463-171670485 GGGAAGGGATACAAAGCTGTGGG + Intergenic
917203479 1:172542928-172542950 GGGAAGTGATTGATAGCTTTTGG + Intronic
918155750 1:181844942-181844964 GGGAAGGGAATCTCAGCAGAGGG + Intergenic
918737547 1:188085517-188085539 GAGAAGAGAATAATAGCTGATGG - Intergenic
921875579 1:220191870-220191892 GGGAAGGGAATGAGAGCAGGAGG - Intronic
1063096669 10:2915012-2915034 AGGAAAGGAAGCATGGCTGTTGG + Intergenic
1067682556 10:48450118-48450140 GAGAGGGGAATCCTAGCTCTGGG - Intronic
1067945627 10:50686481-50686503 GGGAAGGGAATCATAGCTGTGGG - Intergenic
1070867140 10:79713354-79713376 GGGAAGGGAATCATAGCTGTGGG - Intronic
1070880930 10:79851475-79851497 GGGAAGGGAATCATAGCTGTGGG - Intergenic
1071634055 10:87235578-87235600 GGGAAGGGAATCATAGCTGTGGG - Intronic
1071647501 10:87367795-87367817 GGGAAGGGAATCATAGCTGTGGG - Intronic
1071978488 10:90978914-90978936 TGGAAATGAATTATAGCTGTGGG - Intergenic
1073990822 10:109260886-109260908 GGTAATTGAATCATAGGTGTGGG - Intergenic
1076659984 10:132049278-132049300 AGGAAGGGAAGCAAAGCCGTGGG - Intergenic
1076689461 10:132214465-132214487 GGGAAGGAATTCATCTCTGTTGG + Intronic
1078488840 11:11750620-11750642 AGGAAAGGAATCAGAGCTGCAGG - Intergenic
1080407948 11:31996667-31996689 GGGTAGGGCAACATAGGTGTTGG + Intronic
1085628329 11:78090897-78090919 CGGAAGGGAATTATGGCTGAAGG - Intergenic
1086368154 11:86129306-86129328 GGTAATTGAATCATAGATGTGGG + Intergenic
1086973095 11:93104656-93104678 GAAAAGAGAATCATAGCTATAGG - Intergenic
1090400802 11:126447194-126447216 GGGAAGGGGATGAGAGCCGTGGG - Intronic
1091759277 12:3076885-3076907 GGGAAGGGGTTCGTAGGTGTGGG + Intergenic
1097986286 12:65786249-65786271 AGGGAGGGAATCCTAGCTATGGG + Intergenic
1100456638 12:94758013-94758035 GTGAAGGGAGTAAGAGCTGTGGG + Intergenic
1101189338 12:102315134-102315156 GGGAAGGCAATCAAAGCTTCAGG + Intergenic
1101967266 12:109290253-109290275 GGGAAGGTCATCATCGCTGGTGG + Exonic
1102734306 12:115144572-115144594 GGGAAGGGAATGGGAGCTGTTGG + Intergenic
1107463820 13:40630720-40630742 GGGAAGGGAAAAATAGTTTTAGG - Intronic
1107929032 13:45291260-45291282 GGGAGGTGAATGATAGCTGTGGG - Intergenic
1110882708 13:80592230-80592252 AGGAAGGGAATCATATTTGAAGG - Intergenic
1112144789 13:96686818-96686840 GGGATGGGATTCATAGCCATAGG + Intronic
1113009269 13:105744863-105744885 GGAAAGGGAAGCATTGTTGTAGG + Intergenic
1113037260 13:106063786-106063808 GAGAAGGGCATCGCAGCTGTTGG - Intergenic
1114860647 14:26516475-26516497 TGGAAAGAAAACATAGCTGTTGG - Intronic
1116103475 14:40470223-40470245 GAGAAGGGAATGATAGATGCGGG + Intergenic
1116391768 14:44400310-44400332 GGGAAGGGCAGCAGAGGTGTGGG + Intergenic
1117780853 14:59230323-59230345 GGTAAGGGAATCCTAGCTTGTGG - Intronic
1118432159 14:65729810-65729832 GGCAGGGGAGTTATAGCTGTTGG - Intronic
1118919725 14:70139144-70139166 GGGAAGGGAGTGATGGTTGTTGG - Intronic
1122725534 14:103748530-103748552 GGGAAGGGAGTCCTTGCTGGTGG + Intronic
1122947053 14:105016582-105016604 GGGAAGGAACGCTTAGCTGTGGG - Intronic
1124342423 15:28898584-28898606 GGGGAGGGAAGCACAGCTTTTGG + Intronic
1125604242 15:40930990-40931012 GGAAAGGGAATAATGGCTTTGGG + Intronic
1127672657 15:61210869-61210891 AGGAAGAGAATCATAGCTGTTGG - Intronic
1129513650 15:76143125-76143147 GGGAAGGCAATCAGAGCTCAAGG - Intronic
1131769959 15:95726798-95726820 GGCTAGGGAATCATATCTGTGGG - Intergenic
1131936017 15:97505878-97505900 GGGAAGGGAATCTAAGGTCTTGG - Intergenic
1133551609 16:6861457-6861479 GGGAGGGGAATCATTCCTTTTGG - Intronic
1134438572 16:14283809-14283831 TGGAAGGGAATCTTACATGTTGG + Intergenic
1135892730 16:26372067-26372089 GGGAAGGCAGTCAAAGCTGTAGG + Intergenic
1136086591 16:27889751-27889773 GGTAAGGGAATTGAAGCTGTAGG - Intronic
1138455204 16:57116975-57116997 GGTCAGGGAACCATAGCTGATGG + Intronic
1139717066 16:68822260-68822282 GGGAAGGGAAGCATGGCAGTTGG - Intronic
1140127263 16:72128506-72128528 GGGGAGGGAAGTAGAGCTGTAGG + Intronic
1140917895 16:79509934-79509956 GGGAAGGGACTCACCGCTGAAGG + Intergenic
1141121961 16:81366152-81366174 GGGCATGGAATCATAGATGAAGG - Intronic
1146077619 17:29746061-29746083 GGGAAGGGCATCACAGAGGTAGG + Intronic
1146401614 17:32504322-32504344 GGGAAGGGAAGAATGGGTGTTGG - Intronic
1147786072 17:42979798-42979820 GGGAAGGGAATGACAGGAGTGGG + Intronic
1148218612 17:45847448-45847470 GGGAAGGGCATCCCAGCTGGAGG - Intergenic
1150451728 17:65274547-65274569 GGGAAGGGAAGAAAAGCTGTGGG - Intergenic
1150747050 17:67825115-67825137 GGGAAGGGAATGATATTTGGGGG + Intergenic
1152436084 17:80277259-80277281 GAGGAGGGAGTCATTGCTGTGGG + Intronic
1155354440 18:24937697-24937719 GGCAAGAGAATCATAGCTTTGGG - Intergenic
1155490896 18:26400951-26400973 GAGAAGGGAATAATAAGTGTAGG - Intergenic
1159405966 18:68003455-68003477 AGGAAGGGAATCATTCCTGCTGG + Intergenic
1160244681 18:77147651-77147673 GGGATGGGAATCAGACCTGCTGG + Intergenic
1161163930 19:2775491-2775513 TGAAAGGGAAACAAAGCTGTGGG - Intronic
1164539493 19:29112354-29112376 GGGAATGGAATAACTGCTGTTGG - Intergenic
1166997046 19:46724601-46724623 GGGATGGGAATGATGGCTGTGGG - Intronic
925291770 2:2752620-2752642 GGAAAGGGAACCCTTGCTGTGGG + Intergenic
925569296 2:5291944-5291966 GTGGAAGGAATCATAGCTGGTGG - Intergenic
927672880 2:25083674-25083696 GGGTAGGTAATCAAAGCTGATGG - Intronic
929200796 2:39233391-39233413 GGGAAGGGAAAGACATCTGTTGG + Intergenic
929688847 2:44058022-44058044 GGGAAGGGCATGAAAGATGTTGG + Intergenic
932436244 2:71704010-71704032 GAGAAGGCAAACACAGCTGTGGG - Intergenic
932583075 2:73005158-73005180 GGGCTAGAAATCATAGCTGTTGG - Intronic
932583571 2:73008370-73008392 GGGGAGGGAAGCAGTGCTGTGGG + Intronic
933104144 2:78301377-78301399 GGGAAGGGTGTCAGAGCTGTTGG + Intergenic
933688503 2:85161545-85161567 AGGAAGGGAAAGATTGCTGTTGG + Intronic
936079347 2:109421704-109421726 GGGAAGGGAAACTTATGTGTCGG + Intronic
936988122 2:118331253-118331275 GGGAAGGGAAGCAGAGCGGTAGG + Intergenic
937244557 2:120484204-120484226 AATAAAGGAATCATAGCTGTCGG - Intergenic
937315585 2:120930223-120930245 AGGAAGGCAGTCATCGCTGTTGG - Intronic
937422080 2:121765892-121765914 GCCAAGGGAATTATAGCTGCAGG + Exonic
939367452 2:141251423-141251445 GGGATGGGAATGATGGCTATAGG + Intronic
941089360 2:161157167-161157189 TGGAAGGCAATCAAAGGTGTTGG - Intronic
941181198 2:162261540-162261562 GAGAAGGCAATCATGGGTGTGGG + Intergenic
941692045 2:168510646-168510668 GGAAATGTAATCATAGCTCTTGG - Intronic
942305107 2:174599581-174599603 GGGAAGTGGCTGATAGCTGTAGG - Intronic
943716041 2:191152672-191152694 GAGCAGGGAAACATTGCTGTGGG - Intergenic
946399122 2:219459623-219459645 GGGAACGGAAGCAGAGCTGAAGG - Intronic
946989888 2:225316676-225316698 GGGAAGAGAATTATTCCTGTAGG + Intergenic
947392516 2:229653735-229653757 GGGAAAGAAGTCACAGCTGTAGG - Intronic
948552021 2:238779034-238779056 GGGAAGGGCATTATACCTCTTGG - Intergenic
1170189757 20:13633562-13633584 GGGAAGGAAATCATAGTATTTGG + Intronic
1171073399 20:22098022-22098044 CAGGATGGAATCATAGCTGTGGG + Intergenic
1171401164 20:24873722-24873744 GAGAAAGGAAACATTGCTGTAGG + Intergenic
1172981036 20:38941831-38941853 GGGGAGGGAAGGATAACTGTTGG + Intronic
1173431877 20:42995370-42995392 GGGAAGAGCATCAGAGCTGGGGG + Intronic
1173466016 20:43282018-43282040 AGGAAGGTCATCATGGCTGTGGG - Intergenic
1183040726 22:35175848-35175870 GGGAATCTATTCATAGCTGTTGG - Intergenic
1185394415 22:50579390-50579412 GGGATGGGAATGCTAGCTGGGGG - Intronic
949236044 3:1809402-1809424 AGGAAGGAAATCATAGCAGAAGG + Intergenic
951908210 3:27723597-27723619 GCGCAGGGAATCCTAACTGTGGG - Intergenic
953879291 3:46683347-46683369 GGGAAGGGGATCACTGCTGCTGG + Intronic
954988402 3:54816413-54816435 GGGAAGGGAGCGAGAGCTGTTGG - Intronic
958655693 3:97000057-97000079 GACAAAGAAATCATAGCTGTTGG + Intronic
961412707 3:126734285-126734307 GGGGAGGGAAGCATGGCTGTGGG + Intronic
963799588 3:149662553-149662575 GGGAAGGGAAGCATGGATTTTGG - Intronic
965019540 3:163210750-163210772 GAGAACTGAATAATAGCTGTTGG - Intergenic
967024893 3:185556176-185556198 GGAAAGGGAATCATTTCTGTTGG + Intergenic
968523343 4:1044400-1044422 GGGAAGGGAAACATGGCTGCAGG - Intergenic
969170461 4:5358457-5358479 GGGAAGAGATTCAGAGCTGGAGG - Intronic
969876905 4:10142267-10142289 GGGAAGTGAAACCTAGGTGTGGG - Intergenic
970681272 4:18511292-18511314 GAGAAGTGAAGCATAGCTCTGGG - Intergenic
975929698 4:79504786-79504808 GAGAAGGAGATCATAGCTGATGG - Intergenic
979064326 4:116109027-116109049 TGGAAGAGAATTATAGCTGAAGG - Intergenic
980746363 4:137022081-137022103 GGGAAGGGAATCGAAACTCTAGG - Intergenic
982432088 4:155335093-155335115 GGAGAGGGAATCATAGATGAAGG - Intergenic
984919480 4:184751014-184751036 GAGAAGGGATTTAGAGCTGTGGG - Intergenic
985309327 4:188579893-188579915 GGGAGAGAAATCCTAGCTGTAGG - Intergenic
988524497 5:31975386-31975408 GGTAACTGAATCATAGCAGTGGG - Intronic
989799457 5:45518778-45518800 GGGAAGGGAATCTTAGCATATGG + Intronic
992390312 5:76325194-76325216 GAGTAGAGAATCCTAGCTGTTGG - Intronic
993176348 5:84490783-84490805 GGGAAGGGAAACCTTTCTGTGGG - Intergenic
995587125 5:113659773-113659795 GAGAAGGCAATAAGAGCTGTAGG + Intergenic
998057055 5:139087299-139087321 GGTAAGGGAATCAAAGGGGTTGG + Intronic
998106848 5:139474173-139474195 GTGAATGGTATCATATCTGTAGG - Intergenic
999699914 5:154218788-154218810 GAAAAGGTAATCATACCTGTGGG + Intronic
1000560503 5:162782831-162782853 GGGAAGGGAAACAAAGCTCCTGG + Intergenic
1001443241 5:171762385-171762407 GGAAAGGGATTCATAGCCCTGGG - Intergenic
1001764576 5:174235294-174235316 GGGGAGGGGAACATAGCTTTGGG + Intronic
1003306360 6:4932788-4932810 GGCAGGGAAATCATTGCTGTCGG + Intronic
1005536379 6:26760071-26760093 GGGAAGGCAACCAAAGCAGTAGG + Intergenic
1009007279 6:57802470-57802492 GGGAAGGCAACCAAAGCAGTAGG + Intergenic
1009039922 6:58163990-58164012 AGGAAGGGAGACAAAGCTGTGGG - Intergenic
1009215812 6:60918840-60918862 AGGAAGGGAGACAAAGCTGTGGG - Intergenic
1010176500 6:73033704-73033726 GGGAAGGGGGTCATAGAAGTGGG - Intronic
1011459590 6:87589648-87589670 GGTAAAGCATTCATAGCTGTGGG + Intronic
1012498854 6:99865804-99865826 GGGAAAAGAATCACGGCTGTTGG - Intergenic
1012682833 6:102204501-102204523 AGCAAGGGAACCATAGCTCTGGG + Intergenic
1013224085 6:108107226-108107248 GGAAAGGGAATCGCAGCTGGGGG - Intronic
1013338531 6:109190590-109190612 GGTAATGGAATCATGGCGGTGGG + Intergenic
1014004298 6:116399335-116399357 GTGAAGGGAATCATAACTTCTGG - Exonic
1018100552 6:160435195-160435217 GGGAAGGGAAGCATGGATGGTGG + Intronic
1018229611 6:161662971-161662993 GGTAAGTGAATCATAGGGGTGGG + Intronic
1018923750 6:168193108-168193130 GGGAAGGGAAGGATAGCCGGAGG + Intergenic
1021639041 7:22720477-22720499 GTGAAGTAAATAATAGCTGTAGG - Intergenic
1023128399 7:36977727-36977749 CGGAAGGCAAAGATAGCTGTTGG + Intronic
1023292571 7:38683701-38683723 GGGAAGGCAATAGAAGCTGTTGG - Intergenic
1029942812 7:104497950-104497972 GGGAGGGGAACCCTAGGTGTGGG + Intronic
1035996241 8:4550610-4550632 GGTAATGAAATCATAGATGTTGG + Intronic
1036414563 8:8535183-8535205 GGGAATGGAATCATAGGGGCAGG - Intergenic
1039643892 8:39257938-39257960 GGGAAGGGGATCATACCAGAAGG - Intronic
1040275949 8:46013732-46013754 GGGAAGGCATTCTTATCTGTGGG + Intergenic
1041254150 8:55965007-55965029 GAGAAGGGAGTAATAGCTGCTGG - Intronic
1041524011 8:58785708-58785730 GTGATGCGAATCAGAGCTGTGGG + Intergenic
1042241721 8:66670734-66670756 AGGAAGGGAATCATAACTTTGGG + Intronic
1043562958 8:81516393-81516415 TTTAAGGGAATCATGGCTGTTGG - Intergenic
1044300998 8:90582778-90582800 GGGGAGGGAATCATGCCTTTTGG - Intergenic
1046748806 8:117905310-117905332 GGGAAGGGAATAATACTTGTTGG - Intronic
1048007526 8:130431502-130431524 GGGAAGGAAATTCTAGGTGTAGG - Intronic
1048555327 8:135470422-135470444 GGGCAGGGGATTATCGCTGTTGG - Intronic
1048871610 8:138803893-138803915 GGGAAGGGCATCATAGCCAAAGG - Intronic
1051872064 9:21749410-21749432 GTGAAGGTGATCATAGCTGATGG + Intergenic
1052117129 9:24663005-24663027 GGGAAGGGGAACATCACTGTGGG - Intergenic
1053011268 9:34635130-34635152 GGGAAGGGCATCATAGCTGCAGG + Exonic
1055008466 9:71536457-71536479 GGAAAGGCAATCATAGAGGTGGG + Intergenic
1055772075 9:79728126-79728148 GGGAGGGGAATCCAAGCTCTCGG - Intergenic
1057353303 9:94317583-94317605 GGGAAGGGAATCATAGCTGTTGG + Intergenic
1057654448 9:96940009-96940031 GGGAAGGGAATCATAGCTGTTGG - Intronic
1059015104 9:110506819-110506841 GGGAGGGGAAACATAGGTGGAGG + Intronic
1060641450 9:125242098-125242120 GGGAGGGGACTCAGAGCTGGAGG - Intergenic
1060736565 9:126070056-126070078 TGGAAGAGAATTATAGCTGTGGG - Intergenic
1060873145 9:127058931-127058953 AGGCAGGAAATCATAGCTGATGG + Intronic
1062185695 9:135217214-135217236 GGGAAGGGAGTAATTTCTGTTGG - Intergenic
1185910338 X:3975036-3975058 GAAAAGAGAAGCATAGCTGTAGG + Intergenic
1186712296 X:12212060-12212082 AGGAAGGGAAGGATGGCTGTGGG - Intronic
1188802996 X:34554764-34554786 GGGAAGACAATCAAAGCTCTAGG + Intergenic
1189164016 X:38841733-38841755 GCCAAGGGAATCATAGCTTTTGG - Intergenic
1194051579 X:89075732-89075754 GGGAAGACAATCAAAGCTTTAGG - Intergenic
1195807370 X:108790144-108790166 GGTAATGGAATCATAGTGGTGGG + Intergenic
1195851448 X:109286316-109286338 AGGAAGCGAAGAATAGCTGTGGG - Intergenic
1201556587 Y:15269385-15269407 GAGAAGAGAAGCATAGCTATAGG + Intergenic