ID: 1067945628

View in Genome Browser
Species Human (GRCh38)
Location 10:50686482-50686504
Sequence TGGGAAGGGAATCATAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 5, 1: 0, 2: 1, 3: 19, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067945628_1067945634 27 Left 1067945628 10:50686482-50686504 CCACAGCTATGATTCCCTTCCCA 0: 5
1: 0
2: 1
3: 19
4: 207
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data
1067945628_1067945633 -1 Left 1067945628 10:50686482-50686504 CCACAGCTATGATTCCCTTCCCA 0: 5
1: 0
2: 1
3: 19
4: 207
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067945628 Original CRISPR TGGGAAGGGAATCATAGCTG TGG (reversed) Intergenic
901101154 1:6720117-6720139 TGGGAAGGGGACCAGTGCTGTGG - Intergenic
901897306 1:12325130-12325152 CTGGAATGCAATCATAGCTGTGG + Intronic
901987563 1:13088203-13088225 TGGGAGGAGAAGCATAGCTAAGG - Intergenic
901994249 1:13138564-13138586 TGGGAGGAGAAGCATAGCTAAGG + Intergenic
902753818 1:18536326-18536348 GGGGAAAGGGATCATAGCAGTGG + Intergenic
904821042 1:33244611-33244633 TGGGAAGGCACTTATGGCTGAGG + Intergenic
904891509 1:33783086-33783108 TGGGAATGGAGTCAGAGGTGGGG + Intronic
906111158 1:43322953-43322975 TGGGATGGGAAACACACCTGTGG - Exonic
909327690 1:74372356-74372378 TGAGAAGAGAAAAATAGCTGAGG - Intronic
909595490 1:77401780-77401802 AGGAAAGGGAATTATAGCAGAGG - Intronic
911296051 1:96116293-96116315 AAAGAAGGAAATCATAGCTGAGG - Intergenic
912483754 1:110007227-110007249 AGGGGAAGGAATCATAGCAGAGG + Intronic
917124057 1:171670462-171670484 AGGGAAGGGATACAAAGCTGTGG + Intergenic
918066813 1:181106830-181106852 TGGCAAGGGAGTCCTAGCTGGGG - Intergenic
918155749 1:181844941-181844963 AGGGAAGGGAATCTCAGCAGAGG + Intergenic
918635032 1:186764913-186764935 GGGTAGGGAAATCATAGCTGGGG + Intergenic
921086715 1:211800857-211800879 AGGGAAGGGAATCATAGAGATGG - Intronic
922389095 1:225120196-225120218 TGGAGATGGAATCATAGCGGGGG + Intronic
922763072 1:228144428-228144450 TGGGATGGGGAGCAGAGCTGAGG - Intronic
923740049 1:236646723-236646745 TGGGAAGGGAATCCTAGGTGTGG - Intergenic
1063851865 10:10201220-10201242 TGGGAATGCAGTCATAGGTGGGG + Intergenic
1067945628 10:50686482-50686504 TGGGAAGGGAATCATAGCTGTGG - Intergenic
1069190452 10:65480685-65480707 TGGAAAGAGAATAATAGCTGAGG - Intergenic
1069633986 10:69914261-69914283 TGGGGAGGGACTCTTAGCTTTGG - Intronic
1069907867 10:71742395-71742417 TGGGAAGGGATTCGTGTCTGTGG + Intronic
1070867141 10:79713355-79713377 TGGGAAGGGAATCATAGCTGTGG - Intronic
1070880931 10:79851476-79851498 TGGGAAGGGAATCATAGCTGTGG - Intergenic
1071079873 10:81798346-81798368 AGGAAATGGAATCAAAGCTGGGG - Intergenic
1071634056 10:87235579-87235601 TGGGAAGGGAATCATAGCTGTGG - Intronic
1071647502 10:87367796-87367818 TGGGAAGGGAATCATAGCTGTGG - Intronic
1071978489 10:90978915-90978937 TTGGAAATGAATTATAGCTGTGG - Intergenic
1075443365 10:122496653-122496675 TAGGCAGGGAATCTTATCTGAGG + Intronic
1075978544 10:126717990-126718012 TGGCAAGGGGATCAGAGATGAGG - Intergenic
1078758552 11:14233712-14233734 GGGGATGGGAATCATGGTTGAGG + Intronic
1079075708 11:17384350-17384372 AAGGAAGGGAATCAGCGCTGGGG + Intergenic
1079336632 11:19575857-19575879 AGGTAAGGGAATCACAGCTGTGG + Intronic
1082883416 11:58060123-58060145 TGGGAGAGGAAGCAGAGCTGAGG - Intronic
1083683984 11:64365275-64365297 AGGGAAGGGAATCAGAGGTCAGG - Intronic
1084910868 11:72388228-72388250 GGGGAAGGGAATCTTCTCTGAGG - Intronic
1085529556 11:77183377-77183399 TGGGAAGGGCTTCCTAGCAGAGG + Intronic
1088850597 11:113700257-113700279 TGGCAATGGAATCATGGCTGGGG - Intronic
1090741887 11:129669666-129669688 TGGGAAGCCAATCTTAGCTCAGG + Intergenic
1091847486 12:3668698-3668720 TGTGCAGGCCATCATAGCTGGGG + Intronic
1092348266 12:7734523-7734545 TTGGAAGAGAATAATATCTGAGG + Intronic
1093096080 12:14973717-14973739 TGGGAAGGGAAGTACTGCTGGGG - Intronic
1095539749 12:43295613-43295635 GGAGAAGGGAGTCAAAGCTGAGG - Intergenic
1095951213 12:47783017-47783039 TGGGGTGGGAATCAGAGCTATGG + Exonic
1096533533 12:52256728-52256750 TGGGAAGGGCTTCCTAGCTGGGG + Intronic
1096694394 12:53339282-53339304 TGGGAAGGGAATGGTTCCTGTGG - Intronic
1099700887 12:86080066-86080088 TGGTGAGGGAATCTTAGCTATGG - Intronic
1099946041 12:89245456-89245478 GGTGAAGGGAATAGTAGCTGTGG - Intergenic
1100197443 12:92263074-92263096 TGGGAAGGGAAGCCTGTCTGAGG + Intergenic
1101426347 12:104591542-104591564 TGGGAGGGAAATTTTAGCTGTGG + Intronic
1101888268 12:108688426-108688448 TGGGAAGGTGAACATGGCTGCGG - Intronic
1102717920 12:114990195-114990217 TGGGAAGGGAATCAAGTCTAGGG + Intergenic
1102783309 12:115584145-115584167 TGGGCAGGGAATGAGAGGTGTGG - Intergenic
1102847279 12:116199136-116199158 TGGAAAGGGAATCACAGAGGTGG - Intronic
1103966695 12:124644555-124644577 TGGGAAGGGGCACATAGGTGGGG + Intergenic
1104594533 12:130112205-130112227 TGGGATGGGAAACACTGCTGAGG - Intergenic
1105217891 13:18300117-18300139 TGGGGGGGGAATCAAAGATGAGG - Intergenic
1106385611 13:29282523-29282545 TGGGAGGAGAAGCATAGCAGGGG - Intronic
1107898811 13:44991549-44991571 AGGGAATGGAATTATAGCAGGGG - Intronic
1107929033 13:45291261-45291283 AGGGAGGTGAATGATAGCTGTGG - Intergenic
1109243303 13:59918889-59918911 TGGCAAGGAATTCAAAGCTGTGG + Intronic
1109489661 13:63080326-63080348 TGCGATGGGAATGAAAGCTGGGG - Intergenic
1116103474 14:40470222-40470244 AGAGAAGGGAATGATAGATGCGG + Intergenic
1116391767 14:44400309-44400331 TGGGAAGGGCAGCAGAGGTGTGG + Intergenic
1117116363 14:52517294-52517316 TGCAAAAGGAAACATAGCTGGGG + Intronic
1119117710 14:72041798-72041820 TGGGCAGGGAATGAGATCTGGGG + Intronic
1119935213 14:78585991-78586013 TGGGAAGAGAATCAATGCTTTGG - Intronic
1120324244 14:83005281-83005303 TGGTCAGAGAATAATAGCTGTGG - Intergenic
1121458623 14:94055800-94055822 TGGGAAAGGAATAGTTGCTGAGG - Intronic
1125604241 15:40930989-40931011 TGGAAAGGGAATAATGGCTTTGG + Intronic
1125919763 15:43518429-43518451 TGGGAAGAGAAGCAGAGATGAGG - Intronic
1126109147 15:45165717-45165739 GGGGAAGGGATTGCTAGCTGGGG - Intergenic
1127319218 15:57826360-57826382 AGGGATGGGAATGATATCTGGGG + Intergenic
1128728353 15:70004471-70004493 TGTGAAGGGAAACTTAGGTGAGG - Intergenic
1129222279 15:74137898-74137920 TGGGAAGGGAATCTGGGCTCAGG - Intronic
1130765438 15:86866018-86866040 GGGGAAGGGAAAGATGGCTGAGG - Intronic
1130989910 15:88870083-88870105 GGGGAAGGCATTCATAGCTGAGG + Intronic
1131769960 15:95726799-95726821 TGGCTAGGGAATCATATCTGTGG - Intergenic
1134843533 16:17421315-17421337 TGGGATAGGAAATATAGCTGTGG - Intronic
1135183991 16:20298937-20298959 TGGGAAGAGATTCTTAGCAGTGG + Intergenic
1136355740 16:29744167-29744189 TGGGAAGGGCATCTTCGCTGGGG + Exonic
1138375200 16:56558588-56558610 TGGGTACTGAATTATAGCTGTGG + Intergenic
1140200573 16:72891448-72891470 TGGGAATGTAATGATAGCTATGG + Intronic
1140634113 16:76890276-76890298 TGGTAAGGGGATCATGGCTGTGG + Intergenic
1140847763 16:78906426-78906448 TGGGAAGAGAATTTTAGCTTGGG - Intronic
1140929856 16:79617488-79617510 TGTGAAGGGAGTCAGTGCTGAGG + Intergenic
1141535001 16:84673095-84673117 TGGGCAGGGACTCATAGCTTAGG - Intergenic
1141753702 16:85977056-85977078 TGGGAAGGGGGTCTGAGCTGAGG - Intergenic
1143485312 17:7251067-7251089 TAGGAAGGGAATCCTGGCTGGGG - Intronic
1147368599 17:39975785-39975807 TGTTAAGGGAGCCATAGCTGAGG - Intronic
1148549346 17:48541556-48541578 TGGGAAGGGAAGGAGAGCGGCGG - Intronic
1148858639 17:50592731-50592753 TGGGAAGAGAGGCAGAGCTGAGG - Intronic
1150451729 17:65274548-65274570 AGGGAAGGGAAGAAAAGCTGTGG - Intergenic
1150611579 17:66737785-66737807 TGGGCTGGGATTCAGAGCTGTGG - Intronic
1150747049 17:67825114-67825136 AGGGAAGGGAATGATATTTGGGG + Intergenic
1153747443 18:8194354-8194376 TGGGAAAGAAATCATGGCCGAGG + Intronic
1154392305 18:13948762-13948784 TGTGAAAGGAATCATACATGTGG + Intergenic
1155354441 18:24937698-24937720 AGGCAAGAGAATCATAGCTTTGG - Intergenic
1156926368 18:42585374-42585396 AGGGAAGGGAAGCATAGCAAAGG - Intergenic
1158755281 18:60316740-60316762 TGGAAATGGAAGAATAGCTGGGG + Intergenic
1161062327 19:2221513-2221535 TGGGCTGGGAAGCATGGCTGCGG + Intronic
1164790777 19:30978608-30978630 TGGTAAATGAATCAGAGCTGAGG + Intergenic
1165484752 19:36088972-36088994 TGGGCAGGGGACCCTAGCTGGGG - Intronic
1165848004 19:38831391-38831413 CACGAAGGGACTCATAGCTGTGG + Exonic
1166997047 19:46724602-46724624 CGGGATGGGAATGATGGCTGTGG - Intronic
1167154162 19:47728218-47728240 TGGGAAGGGAATGGGAGATGAGG - Intronic
1167249103 19:48391344-48391366 TCGGAAGAGATTCATGGCTGGGG + Exonic
926349992 2:11985541-11985563 GGGGAAGGGAATGAAAACTGGGG - Intergenic
927057855 2:19383862-19383884 TTGGAAGGGAAGCATATTTGTGG + Intergenic
930580087 2:53200772-53200794 TGGGAAAGAAATCAAAGCAGCGG + Intergenic
934963496 2:98698960-98698982 TGTTAAGGAACTCATAGCTGAGG - Intronic
936698800 2:114984885-114984907 TGGAAATGGACACATAGCTGGGG - Intronic
937234765 2:120423977-120423999 TGAGCAAGGAAACATAGCTGTGG - Intergenic
937989243 2:127653263-127653285 TGGCAGGGGAAGCATGGCTGGGG + Intronic
938603488 2:132867593-132867615 CAGGAAGGGAATAAAAGCTGAGG - Intronic
939681960 2:145147441-145147463 TGGGTAGGGAATCAAAGGTAGGG - Intergenic
940783015 2:157953137-157953159 TAGGCAGGGAATTCTAGCTGGGG + Intronic
947296650 2:228638128-228638150 TGGGATGTGAATCATTTCTGTGG - Intergenic
1169684744 20:8258985-8259007 TGGGAAAGGAAACAAATCTGTGG - Intronic
1169729480 20:8771352-8771374 TGTGAAGGGAATCACATATGTGG + Intronic
1170110337 20:12798000-12798022 TGGGAAGGGATTCCAAGCAGAGG - Intergenic
1171382938 20:24746740-24746762 AAGAAAGGGAATCTTAGCTGTGG - Intergenic
1172909347 20:38395036-38395058 TGGGAAGGGAAGCATGGATAAGG - Intergenic
1173249407 20:41356749-41356771 TGGGCAGGGAGTCATGGATGCGG + Intronic
1173431876 20:42995369-42995391 GGGGAAGAGCATCAGAGCTGGGG + Intronic
1174255657 20:49252832-49252854 TGAGAAGAGAAACATGGCTGAGG + Intronic
1176985704 21:15433237-15433259 GGGGGTGGGAAGCATAGCTGAGG - Intergenic
1178121088 21:29470906-29470928 TTAGAAGGAAATCATAGCTAAGG + Intronic
1178942954 21:36922900-36922922 TGGGATGTGAATTATAGCTGGGG - Intronic
1179087016 21:38226938-38226960 TGGGAGGAGAAGCATAGCTAAGG + Intronic
1179090782 21:38263598-38263620 AGAGGAGGGAATCATAGTTGTGG - Intronic
1183290399 22:36998552-36998574 TGGGAACAGGATCATAGCTAGGG + Intronic
1184368444 22:44067726-44067748 TGGGAACTGCATCAGAGCTGGGG + Intronic
1184925719 22:47635674-47635696 TGTGAAGGGCATCAGAGCAGAGG - Intergenic
1185394416 22:50579391-50579413 GGGGATGGGAATGCTAGCTGGGG - Intronic
951756798 3:26099622-26099644 TGGGAAGGGTATGATTGCTAAGG + Intergenic
952507743 3:34022969-34022991 TGGTAAAGGAAGCATAGCTTGGG + Intergenic
954575786 3:51675387-51675409 AGGCAAGGAAATCAGAGCTGGGG - Intronic
955957739 3:64307984-64308006 TGGAAATGAAATCATAGCTCAGG - Intronic
957532126 3:81453896-81453918 TGGGACGGGGATCATGGCAGTGG + Intergenic
959252594 3:103966659-103966681 TGAGAAGGAAATAAGAGCTGTGG + Intergenic
959538328 3:107512377-107512399 TAGGAAGGGAAGCCTAGATGGGG + Intergenic
961174406 3:124821822-124821844 TGGGGAAGGAAGAATAGCTGAGG - Intronic
961412706 3:126734284-126734306 GGGGGAGGGAAGCATGGCTGTGG + Intronic
962331454 3:134482693-134482715 TGGCAAAGAAATCAAAGCTGTGG - Intronic
964367306 3:155964033-155964055 TGGGGTGGGAATCAAACCTGCGG + Intergenic
964399958 3:156288587-156288609 TGGGAAGGGGAGCACGGCTGGGG + Intronic
964765089 3:160171729-160171751 TGGAGAGGGAATGAAAGCTGAGG + Intergenic
964987799 3:162766121-162766143 TGTGAAGGGAAGCAGCGCTGGGG - Intergenic
965914477 3:173826473-173826495 TGAGTAAGGAATCATGGCTGAGG - Intronic
965926248 3:173984205-173984227 TGGGATGGGGACCATAGCTTTGG + Intronic
967081894 3:186057344-186057366 TGGGAAGAGAGTCATGGCTGAGG + Intronic
967889582 3:194355563-194355585 TGGGAAGGAAGCCATGGCTGTGG - Intronic
969876906 4:10142268-10142290 TGGGAAGTGAAACCTAGGTGTGG - Intergenic
970461862 4:16282738-16282760 TGGGAAGAAAATAAAAGCTGAGG + Intergenic
970559779 4:17271211-17271233 TAGGAATAGAATCAAAGCTGGGG + Intergenic
974941634 4:68476362-68476384 TGGGATGGGAGTCATCGCTGTGG + Exonic
974976739 4:68902429-68902451 TGGGAGGAGAGTCATAGCTAAGG + Intergenic
975450458 4:74519444-74519466 TGGGAAAGCAAACATAGCTGAGG - Intergenic
976598197 4:86914035-86914057 TGGGATGGCAATCCAAGCTGAGG + Intronic
976980716 4:91223610-91223632 TAGGAGGGAAAACATAGCTGAGG + Intronic
978200406 4:106018606-106018628 TGATAAGGGTTTCATAGCTGGGG + Intergenic
981743762 4:148031706-148031728 TTGTAAGGGAGTCACAGCTGTGG + Intronic
981937638 4:150252435-150252457 TGTGAAGGGAGTCATTGCTGGGG + Intronic
984860679 4:184235465-184235487 TGGGAAGGGAATTATCCCTTTGG - Intergenic
985402413 4:189605977-189605999 TGGGAAGGGAATAAAAACTCGGG + Intergenic
986971310 5:13340292-13340314 TGGGAATGGAAGCAAACCTGGGG - Intergenic
989336860 5:40327801-40327823 TGGGAAGACAATCAAAGCTTCGG - Intergenic
991177367 5:63705182-63705204 AGTGAAGGGAATTATGGCTGGGG - Intergenic
993176349 5:84490784-84490806 TGGGAAGGGAAACCTTTCTGTGG - Intergenic
994258902 5:97633962-97633984 TGGGTAGGGAATCAAAGGTAGGG - Intergenic
1001308782 5:170595517-170595539 TGGGCAGGGAATCATCCCAGAGG - Intronic
1001365627 5:171135793-171135815 TGGGAAAGAAGTCCTAGCTGAGG + Intronic
1001404406 5:171465748-171465770 TGGGAAGGGGGTGAGAGCTGGGG + Intergenic
1001525439 5:172425430-172425452 TTGGAAGGGAAGCCTATCTGAGG + Intronic
1001764575 5:174235293-174235315 TGGGGAGGGGAACATAGCTTTGG + Intronic
1001781318 5:174371407-174371429 TGGGGAGTGCATCAGAGCTGAGG - Intergenic
1003790169 6:9537473-9537495 GGGGGAGGGAATTATAGCTGAGG + Intergenic
1004228536 6:13810705-13810727 TGGGAAGGGGAGGGTAGCTGTGG + Intronic
1006375704 6:33670665-33670687 TGAGGTTGGAATCATAGCTGAGG - Exonic
1006502748 6:34468729-34468751 TGGGGAGGGGATCATGGGTGGGG - Intronic
1007158431 6:39769199-39769221 TGGTGAGGGAAACAAAGCTGTGG - Intergenic
1007309409 6:40933660-40933682 TGGAGAGGGAATCATGGGTGGGG - Intergenic
1007972348 6:46065757-46065779 TGGGAAGGGACTCACAGCAAAGG + Intronic
1009039923 6:58163991-58164013 TAGGAAGGGAGACAAAGCTGTGG - Intergenic
1009215813 6:60918841-60918863 TAGGAAGGGAGACAAAGCTGTGG - Intergenic
1010363957 6:75028295-75028317 TGAGAAGGGAAGCTTAGCAGTGG + Intergenic
1012244571 6:96912190-96912212 TGGGAAGGGATTAAGAGTTGAGG - Intergenic
1013224086 6:108107227-108107249 GGGAAAGGGAATCGCAGCTGGGG - Intronic
1013634681 6:112017803-112017825 TGGGAGGACAATCATAGCTTAGG - Intergenic
1015904784 6:138106261-138106283 GTGGATGGGAATCACAGCTGGGG - Intronic
1016775278 6:147898047-147898069 TGGCAAGTGGATCACAGCTGAGG + Intergenic
1022538472 7:31113422-31113444 TGGGAAGGTAATCATTGCCCAGG - Intergenic
1024582696 7:50812862-50812884 AGGCAAGGGAATCATAGCCAGGG + Intergenic
1024731929 7:52262697-52262719 TGAGAAAGGAGTGATAGCTGAGG - Intergenic
1033356173 7:140601979-140602001 CGGGAAGTGGATCCTAGCTGGGG - Exonic
1033868272 7:145718666-145718688 AGGGATGGGCATCATGGCTGCGG - Intergenic
1035098202 7:156374209-156374231 TGGGAATGGACTCACAGCCGGGG - Intergenic
1035348856 7:158228862-158228884 TGTGAAGGGAAACATCCCTGAGG + Intronic
1035766977 8:2114021-2114043 GGGGAAGGGAGGCAGAGCTGTGG + Intronic
1041007397 8:53508440-53508462 GGGGAAGGGAACCATTGCTGGGG - Intergenic
1041524010 8:58785707-58785729 TGTGATGCGAATCAGAGCTGTGG + Intergenic
1042241720 8:66670733-66670755 AAGGAAGGGAATCATAACTTTGG + Intronic
1042507210 8:69573309-69573331 TGAGAGGAGAATCCTAGCTGGGG + Intronic
1043382975 8:79722723-79722745 TGGGAAGGCAATCAGGGCTCAGG + Intergenic
1049133110 8:140867042-140867064 TGGGAAGGCAAGTGTAGCTGGGG + Intronic
1050527216 9:6556460-6556482 TGTGAAGGGAGTAATGGCTGTGG - Intronic
1051393042 9:16587385-16587407 TGTGAATGGAATCGTAGCTCAGG - Intronic
1052833929 9:33236401-33236423 TGGGAAGGCAAACAAGGCTGAGG + Intronic
1053555763 9:39135417-39135439 TGGAAAGGGGATCAGAGGTGTGG + Intronic
1054930177 9:70627710-70627732 TGTGAAGGGCATCATATATGAGG + Intronic
1055052390 9:71993746-71993768 TGGGAATGGTATCATATCAGAGG - Intergenic
1060314004 9:122491471-122491493 AGGGAAGGGAATAGTTGCTGAGG + Intergenic
1060736566 9:126070057-126070079 TTGGAAGAGAATTATAGCTGTGG - Intergenic
1061119480 9:128634405-128634427 AGGCAAGGGAATCAGTGCTGGGG + Intronic
1062019721 9:134313326-134313348 TGGAAATGGTATCATATCTGTGG - Intergenic
1062250686 9:135592201-135592223 TGGGAGGGGAGACTTAGCTGGGG - Intergenic
1062564540 9:137158355-137158377 TAGGGAAGGAAGCATAGCTGAGG - Intronic
1187685781 X:21814328-21814350 TTGCATGGGACTCATAGCTGTGG + Intergenic
1190480202 X:50869954-50869976 AGGGAAGAGAAGCCTAGCTGTGG + Intergenic
1192810444 X:74542566-74542588 TGGGAACTGAATCCTAGGTGGGG - Intergenic
1193585548 X:83317534-83317556 TAGGATGGGATTCATAGCTTAGG + Intergenic
1194620267 X:96162326-96162348 TGGAGATGGAATCATAGCAGAGG + Intergenic
1195285886 X:103383288-103383310 TGGGTGGGTCATCATAGCTGAGG - Intergenic
1196491978 X:116278295-116278317 TAGGAAGGGAATGAGATCTGCGG + Intergenic
1199163125 X:144637914-144637936 AGGTAAGTGAATCATGGCTGTGG - Intergenic
1200880998 Y:8211113-8211135 TGGGAAGGATATCATTTCTGAGG + Intergenic
1201353166 Y:13068850-13068872 TGGGAATGAAATCATAGCATCGG + Intergenic
1201464307 Y:14263597-14263619 TGAGAAGAGAATCATAGAAGTGG - Intergenic