ID: 1067945629

View in Genome Browser
Species Human (GRCh38)
Location 10:50686496-50686518
Sequence GTTCAGTCATCATATGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 7, 1: 0, 2: 0, 3: 5, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067945629_1067945634 13 Left 1067945629 10:50686496-50686518 CCCTTCCCATATGATGACTGAAC 0: 7
1: 0
2: 0
3: 5
4: 124
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067945629 Original CRISPR GTTCAGTCATCATATGGGAA GGG (reversed) Intergenic
903384584 1:22918106-22918128 GTTCAGCCATCAGATGGGGCAGG + Intergenic
903445109 1:23418025-23418047 GTTAAGGCATAATCTGGGAATGG + Intronic
910955171 1:92695551-92695573 GATCAAGCATCATATGGAAAAGG + Intronic
912848772 1:113103285-113103307 GATCAGACATCACCTGGGAATGG - Intronic
917494938 1:175531831-175531853 GTTCAGCCATCAGAGGGGATTGG + Intronic
920122742 1:203670932-203670954 ATTCAGTTATCATATGAGATGGG + Intronic
922666390 1:227473298-227473320 GTTCAGTGAACATATAGCAAGGG + Intergenic
1063722199 10:8595547-8595569 GTTGAGTCTTCTTATGGGCAGGG + Intergenic
1065149299 10:22805848-22805870 CTGGAGTCATCATCTGGGAAAGG - Intergenic
1067945629 10:50686496-50686518 GTTCAGTCATCATATGGGAAGGG - Intergenic
1068235247 10:54225565-54225587 CTTCAGTGATTATAAGGGAATGG - Intronic
1069552510 10:69374441-69374463 GTTCAGTTATCACAAGGAAAAGG + Intronic
1070867142 10:79713369-79713391 GTTCAGTCATCATATGGGAAGGG - Intronic
1070880932 10:79851490-79851512 GTTCAGTCATCATATGGGAAGGG - Intergenic
1071634057 10:87235593-87235615 GTTCAGTCATCATATGGGAAGGG - Intronic
1071647503 10:87367810-87367832 GTTCAGTCATCATATGGGAAGGG - Intronic
1072587794 10:96798118-96798140 GTTCAGACATCTTCTGGGCAAGG + Intergenic
1074329558 10:112491760-112491782 GCTCAGTCATCACATGTGGATGG + Intronic
1078603811 11:12757353-12757375 CTCCAGTCATCAAAAGGGAAAGG + Intronic
1087453943 11:98359224-98359246 GTTCAGTGATCATTTGGAACAGG + Intergenic
1088470016 11:110181008-110181030 ACTCATTCATCATATGTGAACGG - Intronic
1089333205 11:117704410-117704432 GTGCACACAACATATGGGAAGGG - Intronic
1091757353 12:3062869-3062891 CTGCAGTCATAATATGGCAAAGG - Intergenic
1092053694 12:5491636-5491658 GCCCAGTCATCACATGGAAAAGG + Intronic
1095426008 12:42075377-42075399 GTTCAGTCAGCGTCTGGCAATGG - Intergenic
1096288731 12:50323115-50323137 ATTCTGTCATCATATGGAAGTGG + Intergenic
1096407054 12:51351503-51351525 GATGAGTCCTCAGATGGGAAGGG - Exonic
1096766539 12:53895393-53895415 CTTCACTCATCATTTGGCAAGGG + Intergenic
1097313920 12:58151982-58152004 ACTCAGTCATCAAATGGAAATGG - Intergenic
1098381645 12:69876451-69876473 GTTTAATCATCATATAAGAAGGG + Intronic
1101153817 12:101908645-101908667 GATCAGACATCACCTGGGAAGGG + Intronic
1105706058 13:22967961-22967983 GTTCAGGCAGCCTATGGGCAGGG + Intergenic
1109994984 13:70111429-70111451 GCACAGGCATCATATGGCAATGG + Intergenic
1114026880 14:18535836-18535858 GTTCAGGAATCATATGTGAGTGG - Intergenic
1117215199 14:53544441-53544463 GTTCACTCAGCATATAGAAATGG + Intergenic
1120729235 14:87983355-87983377 TTTCAGTCATAATTTGGAAAAGG + Intronic
1125928788 15:43584840-43584862 CTTCAGGCAGCAAATGGGAAAGG + Exonic
1125941954 15:43684675-43684697 CTTCAGGCAGCAAATGGGAAAGG + Intergenic
1127147693 15:56041808-56041830 ATTCTGTCATCATGTAGGAATGG + Intergenic
1131445227 15:92493314-92493336 GTTCTTTCTTCATTTGGGAAGGG - Intronic
1131782466 15:95874364-95874386 ATACAGTCATCATTAGGGAAGGG + Intergenic
1132834102 16:1943660-1943682 TTTCAGTCATCATTTTGCAAAGG - Intergenic
1135833284 16:25798089-25798111 GTTAAGTCATCATATCTCAAAGG + Intronic
1138787395 16:59863764-59863786 TTTCAGTCAACAGATGGCAAAGG - Intergenic
1140708031 16:77649174-77649196 GTTGAGGGATCATGTGGGAAGGG - Intergenic
1142633292 17:1240211-1240233 TCTCAGTCATCATTTTGGAAAGG - Intergenic
1142794549 17:2297451-2297473 GTTCAGACATCCTATGAAAAGGG + Intronic
1144941386 17:18944042-18944064 GCTCAGTTATCAGATGGAAAGGG - Intergenic
1144958349 17:19030966-19030988 GTTCAGTGACCAGATGGGCAGGG + Intronic
1144976809 17:19143558-19143580 GTTCAGTGACCAGATGGGCAGGG - Intronic
1160073592 18:75650437-75650459 GTCCAGTCATCATTGGGAAATGG + Intergenic
1161801815 19:6420492-6420514 GGTCAGTCCTCAAGTGGGAAGGG + Intronic
1164797185 19:31043406-31043428 TTTCACCCATCATATTGGAAAGG + Intergenic
929352687 2:40978300-40978322 GTTAAGTCATCAGATGGCATGGG + Intergenic
933254007 2:80060179-80060201 GTTCAGTGAACCTATGGGAGGGG - Intronic
936854709 2:116942881-116942903 TTTCAGCAATTATATGGGAATGG + Intergenic
938778692 2:134564498-134564520 ATGCATTCATCATAAGGGAAAGG + Intronic
940017598 2:149123115-149123137 ATTCAGTCATCACATGGAACAGG + Intronic
940108354 2:150123800-150123822 GTTTAGTCAATATATGGCAAAGG + Intergenic
943006912 2:182395994-182396016 ATTCAGTCATCAAATGGAAGTGG + Intronic
944409647 2:199426766-199426788 GTGCAGTCATAATTTTGGAAAGG - Intronic
947023443 2:225709955-225709977 TTGCAGTAATCATATGGTAAAGG - Intergenic
947346311 2:229192960-229192982 TTTCAGTCATCATATCCAAATGG + Intronic
1175677961 20:60962804-60962826 CTTCAGTCCTCACCTGGGAAAGG - Intergenic
1175735751 20:61385911-61385933 GTTCATGCATCATGTGGGTAAGG + Intronic
1179454600 21:41490443-41490465 GCTCAGTCATCATATGTGGCTGG + Intronic
1180451016 22:15463031-15463053 GTTCAGGAATCATATGTGAGTGG - Intergenic
1180883462 22:19223193-19223215 GTGCCATCATCATCTGGGAATGG - Intronic
1183094611 22:35544526-35544548 GTGCATTCATCAAATGGCAAAGG - Intronic
1185363591 22:50423908-50423930 GTTCAGTCAGAACATGAGAAAGG - Intronic
952536928 3:34321188-34321210 GATTAGTCTTCATGTGGGAAAGG - Intergenic
953621465 3:44536334-44536356 GCTCAGCCATCACATTGGAAGGG + Intergenic
958885326 3:99720199-99720221 GTTCAGTCATAATATGGTGTTGG - Intronic
960485219 3:118244128-118244150 ATTCATTCATCATATTTGAATGG + Intergenic
961910041 3:130305095-130305117 ATTCAAGCATCATATGGGGATGG + Intergenic
962756058 3:138466146-138466168 TTTGAGTCATCATCTGGGAGAGG + Intronic
963306180 3:143655801-143655823 TTTCAGCCATCAAATGGTAAGGG + Intronic
965417426 3:168414451-168414473 TTTCAGTTTTCATGTGGGAATGG + Intergenic
971542421 4:27836235-27836257 GTTCAGTGATGATAATGGAAAGG - Intergenic
972635008 4:40876368-40876390 GTTCAGTGATTACCTGGGAAAGG - Intronic
974720867 4:65736598-65736620 GTTCAGTTATCAAGTGGAAAGGG - Intergenic
975313100 4:72925331-72925353 CTTCAGTCAGCATATGATAAAGG + Intergenic
975957685 4:79861278-79861300 TTTCAGTGACCCTATGGGAACGG - Intergenic
976478143 4:85508646-85508668 GTCCAGGCATCAAATGGTAAGGG - Intronic
976894834 4:90096970-90096992 GTTGTGTCATCATAAGGGAAAGG - Intergenic
978554509 4:109964480-109964502 GCTCAGCCAGCAGATGGGAATGG + Exonic
978828447 4:113053061-113053083 GTTCAGACATGATATGGGAGTGG + Intronic
980860036 4:138487941-138487963 GTTTAGACATCATGTGAGAATGG - Intergenic
981984901 4:150842105-150842127 TTTCAGTAATCATATAGTAAAGG + Intronic
982944854 4:161607618-161607640 TTTCAGATATCCTATGGGAATGG + Intronic
985938366 5:3114045-3114067 GTTCAGCTATCATATGGTATTGG - Intergenic
987330118 5:16849150-16849172 TTTCAGTTATCAAATAGGAAGGG - Intronic
987666357 5:20946471-20946493 GAGCAGGCATCATATGGCAAGGG - Intergenic
990878594 5:60516484-60516506 CTAGAGACATCATATGGGAAAGG - Intronic
992109424 5:73478824-73478846 GTTAAGTCATCTAATGGGTAGGG + Intergenic
995284506 5:110371587-110371609 GCTGAGTCATCATATGATAAAGG - Intronic
996518624 5:124401374-124401396 GTTCAGGAATCAGATGGGGAAGG - Intergenic
996580462 5:125027042-125027064 GCTCAGTCATGAGAGGGGAAGGG - Intergenic
997218022 5:132130480-132130502 GTTCTGTCAGCCTGTGGGAAGGG - Intergenic
997607496 5:135185597-135185619 GATCAGTCAGCATTTGGGCATGG + Intronic
998842271 5:146267342-146267364 GTTCAGTCATGATTAGGGATTGG + Intronic
999385370 5:151150551-151150573 GGACAGTCATCATATGGGGTTGG + Intronic
1000447358 5:161338942-161338964 GTACAGTTATCCTATGGGATAGG - Intronic
1001001075 5:168007543-168007565 TTTCAGTCATGATCTGAGAAAGG + Intronic
1001281199 5:170387694-170387716 GTTCTGTGATCTTGTGGGAATGG + Intronic
1003106352 6:3219405-3219427 GCTCAGTCAGCTTGTGGGAAAGG + Intergenic
1004351536 6:14894308-14894330 GTTCAGTCAATACATGAGAATGG + Intergenic
1006291421 6:33140252-33140274 GTTCTGAGATCCTATGGGAATGG - Intergenic
1006838595 6:37014145-37014167 GCTCAGTAAGTATATGGGAATGG - Intronic
1010058308 6:71590450-71590472 GTTCATTCATCAAATGGAAGAGG + Intergenic
1013791488 6:113842344-113842366 GATCAGTCATCAAATTTGAATGG - Intergenic
1014573391 6:123039757-123039779 GTTTAGTCATCATAACTGAATGG - Intronic
1014732971 6:125055767-125055789 TTTCATTCATTATATTGGAAAGG + Intronic
1021393197 7:20119583-20119605 GCTCAGGCACCATTTGGGAATGG - Intergenic
1021572053 7:22075872-22075894 GTTCAGTTACCATCTGGGAAAGG + Intergenic
1023302779 7:38791761-38791783 GATCAGTTATCCTATGGGCAAGG + Intronic
1026432838 7:70365006-70365028 GTTTAGACATCATATGTAAATGG + Intronic
1030918423 7:115347251-115347273 GTTTTGTCATCATATAGGAATGG + Intergenic
1033735459 7:144217468-144217490 GTCCAGTCATCCTAGGGGATTGG + Intergenic
1033747595 7:144333501-144333523 GTCCAGTCATCCTAGGGGATTGG - Intergenic
1035079362 7:156203318-156203340 GTTCAGTAAATACATGGGAACGG - Intergenic
1039851959 8:41376350-41376372 ATTCAGTGTTCATCTGGGAAAGG + Intergenic
1040848809 8:51876784-51876806 GTTCATTCATCATTTAGGTATGG - Intronic
1051882165 9:21850814-21850836 ATTCAGTTATCAAATGGAAATGG + Intronic
1052067441 9:24039563-24039585 GTTTAGTCATCATTTGGAACAGG + Intergenic
1052693070 9:31840433-31840455 TTCCAGTCATCATAGGGGACAGG - Intergenic
1053719510 9:40931209-40931231 GTTCTGTAATCCTATGTGAAGGG - Intergenic
1057353302 9:94317568-94317590 GTTCAGTCATCATATGGGAAGGG + Intergenic
1057654449 9:96940024-96940046 GTTCAGTCATCATATGGGAAGGG - Intronic
1058717150 9:107732900-107732922 GATCAGTCAGCAGAAGGGAATGG - Intergenic
1059429124 9:114239637-114239659 GTACAGTCATCCCAGGGGAATGG + Intronic
1059721821 9:116967419-116967441 GTTCTGTCACCCTTTGGGAAAGG + Intronic
1192049394 X:67709926-67709948 ATTCAAGCATCATATGGGAATGG - Intronic
1193854060 X:86576866-86576888 GTGCAGAGATTATATGGGAAGGG - Intronic
1194915263 X:99699352-99699374 GTTATGTCAACATAAGGGAAAGG + Intergenic
1197459156 X:126718562-126718584 GTTTAGTCATCATAAAAGAAGGG - Intergenic