ID: 1067945630

View in Genome Browser
Species Human (GRCh38)
Location 10:50686497-50686519
Sequence AGTTCAGTCATCATATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 7, 1: 0, 2: 1, 3: 4, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067945630_1067945634 12 Left 1067945630 10:50686497-50686519 CCTTCCCATATGATGACTGAACT 0: 7
1: 0
2: 1
3: 4
4: 117
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067945630 Original CRISPR AGTTCAGTCATCATATGGGA AGG (reversed) Intergenic
904196642 1:28790596-28790618 AGTCAAATCATCCTATGGGAAGG + Intergenic
906118615 1:43372366-43372388 AGTTCAGAGGGCATATGGGAGGG + Intergenic
907513264 1:54978129-54978151 AGTTCAGGCATGATATGGTAGGG + Intergenic
913159266 1:116130535-116130557 ACTCAAGTCATCATCTGGGATGG - Intronic
918736912 1:188076012-188076034 AGTACAGACATCAAAAGGGATGG - Intergenic
920122741 1:203670931-203670953 CATTCAGTTATCATATGAGATGG + Intronic
923822490 1:237460469-237460491 AGATGAGTCAACATTTGGGATGG - Intronic
1063722198 10:8595546-8595568 AGTTGAGTCTTCTTATGGGCAGG + Intergenic
1066465663 10:35647895-35647917 AGTTAAGTCTCCAAATGGGAGGG - Intergenic
1067945630 10:50686497-50686519 AGTTCAGTCATCATATGGGAAGG - Intergenic
1070867143 10:79713370-79713392 AGTTCAGTCATCATATGGGAAGG - Intronic
1070880933 10:79851491-79851513 AGTTCAGTCATCATATGGGAAGG - Intergenic
1071634058 10:87235594-87235616 AGTTCAGTCATCATATGGGAAGG - Intronic
1071647504 10:87367811-87367833 AGTTCAGTCATCATATGGGAAGG - Intronic
1072068332 10:91891994-91892016 AGTTCGTCCATCATTTGGGAGGG + Intergenic
1072505460 10:96062093-96062115 GGCTCAGGGATCATATGGGAAGG + Intergenic
1076400430 10:130180490-130180512 AGTGCAGGCTTCAAATGGGATGG + Exonic
1078260716 11:9704810-9704832 AGGTCAGTCAACATCTGGTATGG - Intronic
1078953868 11:16167495-16167517 ACTTTAGTCTTCAAATGGGATGG - Intronic
1080016866 11:27516754-27516776 AGTTCACTCATAATCTGAGATGG + Intergenic
1080321084 11:31010077-31010099 AGTGCCGTCATGATATGGGTTGG - Intronic
1081343640 11:41956598-41956620 ACCACAGTCATCATATGGTAAGG + Intergenic
1081520742 11:43878881-43878903 AGTTAAGGCATCAATTGGGAAGG - Intergenic
1093208141 12:16275754-16275776 AGGTCAGTCATCAGACAGGATGG - Intronic
1093821043 12:23617972-23617994 AGGTCATACATCATATGGGGAGG - Intronic
1095855831 12:46860247-46860269 ACCTCAGTAATCATATGGGTTGG - Intergenic
1096407055 12:51351504-51351526 AGATGAGTCCTCAGATGGGAAGG - Exonic
1098381644 12:69876450-69876472 AGTTTAATCATCATATAAGAAGG + Intronic
1105256186 13:18745205-18745227 AGTGCAGTCCTGAGATGGGACGG + Intergenic
1105687624 13:22801201-22801223 AATTTGGTCATCATCTGGGAGGG - Intergenic
1106763792 13:32893785-32893807 AGTTTAGTCATTAGTTGGGAAGG - Intergenic
1108627739 13:52247935-52247957 AGTTCATTCATCATACTGAATGG - Intergenic
1108658323 13:52558518-52558540 AGTTCATTCATCATACTGAATGG + Intergenic
1108716047 13:53078798-53078820 AGTTCAGTCACAGTCTGGGATGG + Intergenic
1113377302 13:109776745-109776767 AGTAAAGTCATCATTTGGCATGG - Intronic
1114022281 14:18491097-18491119 AGTTCTGTAATCCTATGTGAGGG - Intergenic
1114027319 14:18539879-18539901 TGTTCTGGAATCATATGGGAGGG - Intergenic
1115173291 14:30532850-30532872 ACTTCTGTCAGCATGTGGGATGG + Intergenic
1115390276 14:32846532-32846554 ACTTCTGTGATCATATAGGAAGG + Intergenic
1117440525 14:55755002-55755024 AGTTCAGTCTGCATCAGGGAAGG + Intergenic
1118599266 14:67460177-67460199 AGTTCATTCAGCAAAAGGGATGG + Intronic
1125463214 15:39925783-39925805 GTCTCAGTCACCATATGGGAGGG + Intergenic
1126498535 15:49319309-49319331 AGGTCTGTCTTCATTTGGGATGG + Intronic
1129762838 15:78140957-78140979 AGATCAGTGTTCGTATGGGAGGG + Intronic
1129996450 15:80010347-80010369 TGTTCAGTCATCATCTGAGGGGG - Intergenic
1131445228 15:92493315-92493337 AGTTCTTTCTTCATTTGGGAAGG - Intronic
1131896733 15:97040907-97040929 AGTTCAGTAATAAAATGGAATGG + Intergenic
1134850129 16:17471961-17471983 AGAACAGTGAGCATATGGGATGG + Intergenic
1138183575 16:54959701-54959723 AGTTTTGTGATCATGTGGGAAGG + Intergenic
1140783182 16:78314926-78314948 AGGTCAGTTAACACATGGGATGG + Intronic
1141303952 16:82843683-82843705 AGATTTGTCATCACATGGGAAGG - Intronic
1143724808 17:8837621-8837643 AGTTCTCTCTCCATATGGGAGGG + Intronic
1203156202 17_GL000205v2_random:6000-6022 TGTTCTGTAATCCTATGGGAGGG + Intergenic
1155734647 18:29205433-29205455 ATGTGAGTCATCATATGTGATGG - Intergenic
1156986275 18:43354601-43354623 AGTTCAGGAACCAAATGGGATGG - Intergenic
1158019256 18:52822065-52822087 AGTTCAGTGGACATATTGGATGG - Intronic
1159445172 18:68533431-68533453 AGTTCAGTTTCCATTTGGGAGGG + Intergenic
1160169043 18:76537825-76537847 AGCTCGGACATCATGTGGGATGG - Intergenic
1161801814 19:6420491-6420513 AGGTCAGTCCTCAAGTGGGAAGG + Intronic
1162314294 19:9928330-9928352 AGTTCAGCCATCAAATGAAATGG - Intronic
1162641732 19:12015622-12015644 AGTTCTTTCATGATATCGGAAGG + Exonic
1163363534 19:16863106-16863128 AGTTGAGTATTCATCTGGGATGG + Intronic
1168624023 19:57902511-57902533 AGTTCAATCACAATTTGGGAGGG + Intronic
1202651084 1_KI270707v1_random:4169-4191 TGTTCTGTAATCATATGTGAGGG - Intergenic
928189623 2:29151008-29151030 AATTCATTCATCATATTGGCAGG + Intronic
929065282 2:37966728-37966750 AGTTCAGTTATCATATGAGAGGG + Intronic
929352686 2:40978299-40978321 TGTTAAGTCATCAGATGGCATGG + Intergenic
933254008 2:80060180-80060202 AGTTCAGTGAACCTATGGGAGGG - Intronic
935722657 2:105993180-105993202 AGTTCAATCAAAATTTGGGAGGG + Intergenic
939396931 2:141642713-141642735 CGTTCATGCCTCATATGGGAGGG + Intronic
943982386 2:194570963-194570985 AATTCATTCACCAGATGGGATGG - Intergenic
948536522 2:238651291-238651313 AGTCCAGTTATCATCAGGGATGG - Intergenic
948536541 2:238651357-238651379 AGTCCAGTTATCATTAGGGATGG - Intergenic
1172737254 20:37136369-37136391 AGTCCAATCATCATATACGATGG + Intronic
1173181767 20:40811771-40811793 AGTTCTGTCCTCATCTGGGTGGG - Intergenic
1173370786 20:42433042-42433064 AGTTCAGTCATGAGATGGGTGGG + Intronic
1177098519 21:16869789-16869811 AGTTCAAACATCATATGGCTGGG + Intergenic
1179995600 21:44972615-44972637 AGTTCAGTCATCAGGAGGGCAGG + Intronic
1180451466 22:15467168-15467190 TGTTCTGGAATCATATGGGAGGG - Intergenic
1181385556 22:22542932-22542954 AATTCATTCATCATAAGGGTAGG - Intergenic
1181876426 22:25944279-25944301 ATTTCAGTCGGCAAATGGGAGGG - Intronic
1183957111 22:41387450-41387472 AGATTCGCCATCATATGGGATGG - Exonic
951189941 3:19756338-19756360 ATGGCAGTCATCAAATGGGAAGG - Intergenic
955126849 3:56120841-56120863 AGTTCAGTTATCAGATGGCCTGG - Intronic
960523495 3:118682435-118682457 AGTGCAATCACCAGATGGGAGGG - Intergenic
963306179 3:143655800-143655822 ATTTCAGCCATCAAATGGTAAGG + Intronic
966074711 3:175922763-175922785 AGTTCACCCATCACAGGGGAGGG + Intergenic
972032355 4:34477512-34477534 AGTCCTGCCATCATATGGGGGGG + Intergenic
974720868 4:65736599-65736621 AGTTCAGTTATCAAGTGGAAAGG - Intergenic
974720894 4:65736861-65736883 ATTCCAGTCAGCATATGTGAAGG + Intergenic
975115170 4:70672112-70672134 AGATCAGTGATTATCTGGGAAGG + Intronic
975579952 4:75897406-75897428 AGTTTAGGGATCATCTGGGATGG - Intronic
976478144 4:85508647-85508669 AGTCCAGGCATCAAATGGTAAGG - Intronic
978812507 4:112866340-112866362 ACCTTAGTCAACATATGGGAAGG + Intronic
982973069 4:162015602-162015624 AGTTCATCCATCATAAGGAAGGG - Intronic
983292641 4:165825718-165825740 AGTTCAGTCATTCTTTGGAATGG - Intergenic
1202761858 4_GL000008v2_random:119591-119613 TGTTCTGTAATCATATGTGAGGG + Intergenic
987470251 5:18319211-18319233 AGTTCAGACATCATATTGGTAGG - Intergenic
987666358 5:20946472-20946494 AGAGCAGGCATCATATGGCAAGG - Intergenic
993581618 5:89668890-89668912 AGTTCAGTCATGGAATGAGAGGG - Intergenic
996580463 5:125027043-125027065 AGCTCAGTCATGAGAGGGGAAGG - Intergenic
997218023 5:132130481-132130503 AGTTCTGTCAGCCTGTGGGAAGG - Intergenic
1002407830 5:179050009-179050031 AGTTCACTCATCCTGTAGGACGG - Intergenic
1009717438 6:67416869-67416891 AGTTCAGAGATAATAAGGGAGGG - Intergenic
1012136105 6:95558956-95558978 ATTTCACTCAGTATATGGGAAGG + Intergenic
1012762866 6:103324194-103324216 TGTTCAGAGATCATATGGCAAGG - Intergenic
1013905868 6:115218621-115218643 AGTTGAATCATTATAAGGGAAGG + Intergenic
1018311674 6:162516147-162516169 AATTCAGTCATCAGCTGTGAAGG - Intronic
1021255976 7:18392742-18392764 ATTTCATTCTTCACATGGGAGGG + Intronic
1022038199 7:26554060-26554082 AGTTCTGTCATTTTGTGGGAGGG - Intergenic
1029869097 7:103669667-103669689 AGTTCTGTCAACATCTCGGATGG + Intronic
1042910764 8:73823475-73823497 AGTTCAATGATGGTATGGGAAGG - Intronic
1043405091 8:79922638-79922660 AATTGAGTCATCATATGTTATGG - Intronic
1043653243 8:82626947-82626969 AGTGCAGTGATCACAAGGGATGG - Intergenic
1044155373 8:88839655-88839677 AATTCCCTCATCTTATGGGAGGG - Intergenic
1044837565 8:96311208-96311230 ATTTCAGTCACTAAATGGGATGG - Intronic
1050721037 9:8590120-8590142 AGTACAGTCATAATATGAGCTGG + Intronic
1053717587 9:40912411-40912433 TGTTCAGTAATCCTATGTGAGGG - Intergenic
1055775073 9:79759135-79759157 AGTTGGGTCATCTTTTGGGAGGG + Intergenic
1057353301 9:94317567-94317589 AGTTCAGTCATCATATGGGAAGG + Intergenic
1057654450 9:96940025-96940047 AGTTCAGTCATCATATGGGAAGG - Intronic
1058649483 9:107161470-107161492 AGTTGAGTGAGCAGATGGGAAGG + Intergenic
1203542626 Un_KI270743v1:104472-104494 TGTTCTGTAATCATATGTGAGGG + Intergenic
1189287736 X:39863911-39863933 ATTTCGGTCATTATGTGGGAGGG - Intergenic
1189840186 X:45067560-45067582 AGTTCAATCATAATAAAGGAAGG - Intronic
1191989435 X:67018355-67018377 GGTTCTGACATCATTTGGGAGGG - Intergenic
1192912830 X:75623366-75623388 AGTTGAGTCATCATAAGTCAAGG - Intergenic
1194526191 X:94980093-94980115 TGTTCAGTCTTCAAATGGAATGG + Intergenic
1195069851 X:101268211-101268233 AGTACACTCATCATGGGGGATGG + Intergenic