ID: 1067945631

View in Genome Browser
Species Human (GRCh38)
Location 10:50686501-50686523
Sequence CATGAGTTCAGTCATCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 5, 1: 2, 2: 0, 3: 8, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067945631_1067945634 8 Left 1067945631 10:50686501-50686523 CCCATATGATGACTGAACTCATG 0: 5
1: 2
2: 0
3: 8
4: 101
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067945631 Original CRISPR CATGAGTTCAGTCATCATAT GGG (reversed) Intergenic
903384581 1:22918101-22918123 CACCAGTTCAGCCATCAGATGGG + Intergenic
905010772 1:34745673-34745695 CATGTATTCAGTCTTCACATGGG + Intronic
908780109 1:67683026-67683048 CATGACTTCAGTCATCTGAATGG - Intergenic
910340917 1:86186105-86186127 CATGAGAGCAGCCATCATACTGG - Intergenic
913977405 1:143473230-143473252 CATCAGTTCAGAAATAATATTGG + Intergenic
914071809 1:144298861-144298883 CATCAGTTCAGAAATAATATTGG + Intergenic
914107346 1:144667495-144667517 CATCAGTTCAGAAATAATATTGG - Intergenic
915372945 1:155366860-155366882 CAGGGTTTCAGTCATCATGTTGG + Intronic
915434134 1:155890738-155890760 CATGATTTCAGGCATCCTCTGGG + Intergenic
915852380 1:159339316-159339338 CCTGACTTGAGTCATCATAATGG + Intergenic
916632422 1:166630893-166630915 CATCAGTTCAGTCACCATGAAGG + Intergenic
917648763 1:177055283-177055305 CATGAATTCATTCACCATTTGGG - Intronic
1063793844 10:9486970-9486992 CAGGAGTTCACTCATGATTTGGG + Intergenic
1065897040 10:30172520-30172542 CATGAGAGCAGACAACATATAGG + Intergenic
1066481617 10:35800785-35800807 CCTGACTTCATTCATCATAATGG + Intergenic
1066558894 10:36646851-36646873 CATGATCTCAGGCTTCATATTGG - Intergenic
1067945631 10:50686501-50686523 CATGAGTTCAGTCATCATATGGG - Intergenic
1070867144 10:79713374-79713396 CATGAGTTCAGTCATCATATGGG - Intronic
1070880934 10:79851495-79851517 CATGAGTTCAGTCATCATATGGG - Intergenic
1071634059 10:87235598-87235620 CATGAGTTCAGTCATCATATGGG - Intronic
1071647505 10:87367815-87367837 CATGAGTTCAGTCATCATATGGG - Intronic
1074849980 10:117432055-117432077 CATGAGTTCTGGAATCATAGAGG - Intergenic
1074888141 10:117710947-117710969 CATGATTTCATTCATTAGATAGG + Intergenic
1076400832 10:130184079-130184101 CATGAGTTCAGTTAGCTCATGGG + Intronic
1077739889 11:4834109-4834131 CATCAGAGCAGTCATCATCTAGG + Intronic
1079298389 11:19255167-19255189 CATGGGTTCCATCATCACATTGG - Intergenic
1083191379 11:61054915-61054937 GATCAGTTCAGTTACCATATAGG + Intergenic
1088044151 11:105427292-105427314 CATGTTTTCACTCATAATATAGG + Intergenic
1089242545 11:117094950-117094972 CATGAGCTCAGACTTCATATTGG - Intronic
1099216537 12:79860839-79860861 AATGATTTCAGTAATCATACTGG + Intronic
1099497529 12:83369169-83369191 CATTCTTTCAGTCATCTTATAGG + Intergenic
1105221920 13:18338165-18338187 CATCAGTTCAGAAATAATATTGG - Intergenic
1109000862 13:56803203-56803225 CATGATTTCAGGCATCAAGTAGG - Intergenic
1109966015 13:69697474-69697496 CATGAGTACAATCTTCATTTAGG + Intergenic
1112911261 13:104487220-104487242 CATGAGTTCATTCAGCACAGGGG - Intergenic
1115732719 14:36288427-36288449 CAGGAGTTCAGTCTTCAAAGTGG + Intergenic
1116349650 14:43844340-43844362 CATGACCTCAGTTATCTTATGGG + Intergenic
1116670989 14:47843283-47843305 CATGATACCAGTCATCATAATGG - Intergenic
1120733036 14:88023886-88023908 CATGTGTTTAGACATCTTATGGG - Intergenic
1126396363 15:48222704-48222726 AATGAGTTAAGTCACCATCTGGG + Intronic
1127010125 15:54616086-54616108 CATGAGGTAAGTCACCATGTTGG - Intronic
1127522055 15:59752918-59752940 CCTCTGTTCAGTCATCACATAGG + Intergenic
1127901116 15:63341655-63341677 CAAGAGTTCAGGCATCTGATGGG + Intronic
1130437475 15:83915462-83915484 CATGAGTTCAGCCATCCTAGAGG - Intronic
1137647740 16:50090716-50090738 CATGAGTTCCGAAATCATTTAGG + Intronic
1138242635 16:55440335-55440357 CATGTGTACAGTCAGCATAATGG + Intronic
1139186926 16:64817350-64817372 CATGAATTCATTCATCTTTTGGG + Intergenic
1143004475 17:3819807-3819829 GATGAACTCAGTCATCATACAGG + Intronic
1144383809 17:14729788-14729810 CATGTGTTGAGTTAACATATTGG + Intergenic
928023751 2:27723299-27723321 CCTCAGTTCACTCATCATAAAGG - Intergenic
928189622 2:29151004-29151026 AGTGAATTCATTCATCATATTGG + Intronic
928743669 2:34386546-34386568 GATGATTTAAATCATCATATTGG - Intergenic
930919107 2:56729759-56729781 CATGAGTGCAGTGATTATAGAGG - Intergenic
934182111 2:89634228-89634250 CATCAGTTCAGAAATAATATTGG + Intergenic
934292410 2:91708436-91708458 CATCAGTTCAGAAATAATATTGG + Intergenic
936989737 2:118349951-118349973 CTTATTTTCAGTCATCATATTGG - Intergenic
937771965 2:125729619-125729641 CTTGACTACAGTCATCAAATGGG + Intergenic
938511660 2:131953623-131953645 TATGACTTCAGTCATAATAAAGG + Intergenic
940690032 2:156905036-156905058 CAAGAGTTGAGTCTTCATCTTGG - Intergenic
943042485 2:182820183-182820205 CAAGAGTTCAGCCATGAGATTGG + Intergenic
946664405 2:222034179-222034201 CTTGAGTTCAGTCCTCAAGTGGG - Intergenic
1173112877 20:40210650-40210672 AATGATTGCAGTTATCATATGGG + Intergenic
1173370784 20:42433038-42433060 GTTGAGTTCAGTCATGAGATGGG + Intronic
1174198438 20:48789988-48790010 AATGGGTTCATTCAGCATATTGG - Intronic
1174865860 20:54135035-54135057 AATGAGTTCACTCAGCATGTTGG - Intergenic
1176730357 21:10489005-10489027 CATCAGTTCAGAAATAATATTGG - Intergenic
1177891219 21:26806239-26806261 CATTAGTTGATTCATCATACTGG - Intergenic
1179177482 21:39019556-39019578 CAGGATTTCTGTCTTCATATTGG - Intergenic
1179786436 21:43733108-43733130 CATTAGTTCAGTGATAATACCGG + Intronic
1181385557 22:22542936-22542958 CATTAATTCATTCATCATAAGGG - Intergenic
1184879182 22:47294385-47294407 CATGAGGTCAGTCATAATGCAGG - Intergenic
950370665 3:12527297-12527319 CATGACTTTAGTAACCATATAGG - Intronic
950595060 3:13972669-13972691 CATGAGTTTATTCATCACACCGG + Intronic
951867850 3:27327372-27327394 CATAAGTTCAGTCATAAGAGGGG - Intronic
959583890 3:108008191-108008213 CATAAGCTCAGTCATCAACTGGG - Intergenic
963569666 3:146977161-146977183 CACTATTTCAGTCATCATGTGGG + Intergenic
965501528 3:169461790-169461812 CATGATTTAAGGCATCTTATGGG + Intronic
965552285 3:169979454-169979476 TATGAGTTCATTCATGATATAGG - Intronic
966791919 3:183679676-183679698 CATGACTTGAGGCATCATTTAGG + Exonic
977271266 4:94919810-94919832 CATGACTTAAATCATCATCTTGG - Intronic
983182069 4:164659616-164659638 CATGATTTCAGTTGTCATCTTGG - Intergenic
986166556 5:5277468-5277490 AATGATTGCAGTCATCATAAAGG + Intronic
987470252 5:18319215-18319237 TAAGAGTTCAGACATCATATTGG - Intergenic
988707066 5:33736912-33736934 CATGAGTTCAGTCTGCATAAAGG + Intronic
989728318 5:44615952-44615974 CATGAATTCATTCAGCAAATAGG + Intergenic
994096980 5:95856395-95856417 CAAGCGTTCAATTATCATATAGG + Intronic
999385368 5:151150546-151150568 GCTGAGGACAGTCATCATATGGG + Intronic
1004079340 6:12375972-12375994 CATGAGCCCAGTCATCAAAAAGG + Intergenic
1005775346 6:29125238-29125260 CATGACTTCAGTCTTTTTATGGG + Intergenic
1007137827 6:39539828-39539850 CCTCAGTTCAGTCATCAGTTTGG + Intronic
1008771937 6:54989611-54989633 CATAATTTCAGTCATCCAATGGG - Intergenic
1017651742 6:156589598-156589620 CATGAATTAGTTCATCATATTGG - Intergenic
1018397208 6:163387652-163387674 TATGAGTGCTATCATCATATGGG - Intergenic
1018811297 6:167300223-167300245 CATGATTCCAGTCACCATGTTGG - Intronic
1023167510 7:37357320-37357342 CCTGTGTTCAACCATCATATGGG - Intronic
1027992447 7:85379918-85379940 CGTGAGTGCAGACATCATCTTGG - Intergenic
1028715353 7:93959755-93959777 CATGATGTGAGGCATCATATGGG - Intergenic
1030918422 7:115347246-115347268 CATTAGTTTTGTCATCATATAGG + Intergenic
1031183472 7:118446285-118446307 CATGAGTTCAGTCTTCTGATGGG - Intergenic
1033898705 7:146109340-146109362 CATGTGTTCTGTCCTCATAATGG - Intergenic
1034599211 7:152232523-152232545 CATCAGTTCAGAAATAATATTGG + Intronic
1044340593 8:91041906-91041928 CAGGAGTTCAGGCCTCACATGGG - Intergenic
1046247914 8:111590947-111590969 CATGAGTTCACTTAGCATAATGG - Intergenic
1051250111 9:15150933-15150955 CATGGCTACAGTCATCATGTGGG - Intergenic
1057353300 9:94317563-94317585 CACGAGTTCAGTCATCATATGGG + Intergenic
1057654451 9:96940029-96940051 CACGAGTTCAGTCATCATATGGG - Intronic
1059315652 9:113423610-113423632 CAAGAGTTCAGTAAACAAATCGG - Intronic
1059634749 9:116159827-116159849 CATGAACTCAGTGATCATCTGGG + Intronic
1203583926 Un_KI270746v1:45062-45084 CATCAGTTCAGAAATAATATTGG + Intergenic
1188963184 X:36518347-36518369 CATGAGTACAGGCATCAAACAGG - Intergenic
1194995929 X:100591438-100591460 CATGAGCTCAGTCTTCATACGGG + Intronic
1195718744 X:107844969-107844991 AATGAATTCAGTCTTCATAATGG + Intronic
1196707610 X:118729102-118729124 CCTGATTTCCGTAATCATATGGG + Intronic
1197118263 X:122859844-122859866 CATGATTTCAGGCATCCAATGGG + Intergenic
1197923259 X:131619038-131619060 GATGAGTTCAGTCATCTCAGAGG - Intergenic
1198675982 X:139131079-139131101 CATGATTTCAATCCTCAAATTGG - Intronic