ID: 1067945632

View in Genome Browser
Species Human (GRCh38)
Location 10:50686502-50686524
Sequence ACATGAGTTCAGTCATCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 5, 1: 2, 2: 0, 3: 12, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067945632_1067945634 7 Left 1067945632 10:50686502-50686524 CCATATGATGACTGAACTCATGT 0: 5
1: 2
2: 0
3: 12
4: 189
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067945632 Original CRISPR ACATGAGTTCAGTCATCATA TGG (reversed) Intergenic
900940629 1:5796364-5796386 ACAAGAGTTCAGTCACCACCAGG + Intergenic
904913475 1:33952911-33952933 ACGTGAGTTCAGTAAACATATGG - Intronic
907612924 1:55890534-55890556 ACATGAGCTCATTCATTTTATGG + Intergenic
907935156 1:59035147-59035169 AGATGAGGTCAGTCACCACATGG + Intergenic
910644694 1:89500939-89500961 AAATGACTTGAGTCATCATATGG + Intergenic
911369206 1:96976156-96976178 ACATGGGTTCTGTCATTAAACGG + Intergenic
917494936 1:175531825-175531847 AGGTGAGTTCAGCCATCAGAGGG + Intronic
917648764 1:177055284-177055306 ACATGAATTCATTCACCATTTGG - Intronic
918249466 1:182688823-182688845 ACATCAGTTCTGTAATCACAAGG + Intergenic
921377719 1:214491492-214491514 ACATGAGTTAAATTCTCATAAGG + Intronic
921885475 1:220300612-220300634 ACATGAGGTCTGACATCATCTGG + Intergenic
1062993214 10:1840025-1840047 ACATGAGTCAACTCATCAAAAGG + Intergenic
1063793843 10:9486969-9486991 ACAGGAGTTCACTCATGATTTGG + Intergenic
1065220733 10:23493404-23493426 ACCTGCTGTCAGTCATCATAGGG + Intergenic
1066162438 10:32748030-32748052 ACATGAGTTCATTCTTTTTATGG - Intronic
1066790167 10:39053546-39053568 ACATGAATTCACACATCACAAGG - Intergenic
1066811934 10:39350430-39350452 AGATGAATTCAAACATCATAAGG + Intergenic
1066933275 10:41794312-41794334 AGATGAATGCACTCATCATAAGG - Intergenic
1067144285 10:43682637-43682659 ACCTGAGTTCAGTCACCATTTGG - Intergenic
1067945632 10:50686502-50686524 ACATGAGTTCAGTCATCATATGG - Intergenic
1069173173 10:65258212-65258234 ACATGATTTCATTCATTTTATGG - Intergenic
1070867145 10:79713375-79713397 ACATGAGTTCAGTCATCATATGG - Intronic
1070880935 10:79851496-79851518 ACATGAGTTCAGTCATCATATGG - Intergenic
1071634060 10:87235599-87235621 ACATGAGTTCAGTCATCATATGG - Intronic
1071647506 10:87367816-87367838 ACATGAGTTCAGTCATCATATGG - Intronic
1071774624 10:88771587-88771609 ACATGATTTCATTCTTCTTATGG + Intronic
1072466218 10:95664862-95664884 ACATGATTCCAGACATCATCAGG - Intronic
1074147876 10:110732728-110732750 ACATGATTTCAGTCTTCTCAGGG - Intronic
1075162508 10:120036919-120036941 ACATGATTTCATTCTTCTTATGG - Intergenic
1078122051 11:8520716-8520738 ACGTGAGTTCACTCATGATTTGG - Intronic
1078591683 11:12646541-12646563 CAATGTGTTCAGTGATCATATGG - Intergenic
1080957112 11:37110962-37110984 TCATGAGTACAGTGATCCTAGGG - Intergenic
1085777742 11:79381748-79381770 ACATGAGTACTGACTTCATATGG - Intronic
1085926748 11:81032980-81033002 ACAAGAGTGCAGCCACCATAGGG - Intergenic
1086349290 11:85929133-85929155 ATAGGAGTTCAGTCATGATTTGG - Intergenic
1086440673 11:86826261-86826283 TCATGAGTTCACTCATGATTTGG + Intronic
1090455635 11:126846465-126846487 ACATGACTTCAGTAATCTTTGGG + Intronic
1090812043 11:130253441-130253463 ACAGGAGTTCACTCATGATTTGG - Intronic
1092514415 12:9194278-9194300 ACATGAGTTCAGTCCTCTCTGGG - Intronic
1093150165 12:15611355-15611377 ACATGATTTCAGTCTTTTTATGG + Intergenic
1095061159 12:37691375-37691397 ATATGAATTCAGACATCACAAGG + Intergenic
1095127525 12:38499656-38499678 ATATGAGTTCACTCATGATTTGG - Intergenic
1099258107 12:80341332-80341354 ACATGAATTTATTCAACATAGGG - Intronic
1099386931 12:82025552-82025574 ACATGAATTCAGTCTTTTTAAGG - Intergenic
1100304200 12:93335659-93335681 ACATGATTTCAGGCAGTATACGG + Intergenic
1105905408 13:24804896-24804918 ATATGATTTAACTCATCATAAGG + Intronic
1108575249 13:51784815-51784837 ACATAATTTCAGTAATCATGTGG - Intronic
1108791070 13:53969839-53969861 ACATGAAATCAGTCAAAATAAGG + Intergenic
1110076824 13:71256349-71256371 GCATTAGTTCATTCATAATAGGG + Intergenic
1111113177 13:83742372-83742394 ACATTAGTTCAGCCACCATGAGG + Intergenic
1112911262 13:104487221-104487243 TCATGAGTTCATTCAGCACAGGG - Intergenic
1113139318 13:107129272-107129294 AGATGAGGCAAGTCATCATAGGG - Intergenic
1114874472 14:26698524-26698546 AAATGAATCCAGTCATCTTAGGG + Intergenic
1114901719 14:27069182-27069204 ATATGAGTTCATTCATTATGTGG + Intergenic
1114914882 14:27250785-27250807 ACAGGAGTTCACTCATGATTTGG - Intergenic
1114998149 14:28386056-28386078 ATATGAGTTCAGGCATCTTTTGG + Intergenic
1116150921 14:41141306-41141328 GCATAATTTCAGTCTTCATATGG + Intergenic
1118075926 14:62298959-62298981 AGATGAGTTCAGGAATCAGAAGG - Intergenic
1118830945 14:69431884-69431906 ACATGATTTCATTCTTTATATGG + Intronic
1119698873 14:76736441-76736463 ACATGATTTCATTCTTCTTATGG + Intergenic
1124040021 15:26093262-26093284 ACATGACTTCAGTAATCTTTGGG - Intergenic
1127364481 15:58274945-58274967 ACTTGACTTCAGTTTTCATAAGG + Intronic
1127423961 15:58836918-58836940 ACATGAGTGCATTCTTTATAAGG + Intronic
1127686034 15:61345804-61345826 ACAGGAGTTCACTCATGATTTGG - Intergenic
1128481195 15:68040390-68040412 GCATGAGTTGAGAGATCATATGG - Intergenic
1133917201 16:10119906-10119928 ACATGAGTTCATTCTTTTTATGG + Intronic
1136950906 16:34717410-34717432 ACTTGAATTCAATCATCAAATGG - Intergenic
1137094960 16:36242773-36242795 ACTTGAATTCAATCATCAAATGG - Intergenic
1137832969 16:51561968-51561990 GCATGACTGCAGTCATCACATGG - Intergenic
1139579506 16:67864057-67864079 ACATGAGTTCAAGGATCAGAGGG - Intronic
1141245730 16:82305189-82305211 ACAGGAGTTCACTCATGATTTGG + Intergenic
1144587106 17:16493449-16493471 ACATGAGTTAAAGCATCGTAAGG + Intergenic
1145193025 17:20864005-20864027 ACATGACTTCAGTAATCTTTGGG - Exonic
1145298997 17:21617115-21617137 ACATGACTTCAGTAATCTTTGGG + Intergenic
1145403438 17:22566007-22566029 ACATGACTTCAGTAATCTTTGGG - Intergenic
1145723474 17:27093829-27093851 ACATGACTTCAGTAATCTTTGGG + Intergenic
1147854523 17:43468890-43468912 ACATTTGTTCATGCATCATATGG + Intergenic
1150915658 17:69434218-69434240 TTATGAGTTGAGTCATCAAATGG - Intronic
1155111590 18:22720863-22720885 ATAGGAGTTCACTCATCATTTGG - Intergenic
1157178439 18:45473647-45473669 ACAGGAGTTCACTCATGATTTGG + Intronic
1157497437 18:48166523-48166545 ACATGAGTGATGTCATCACAGGG + Intronic
1159585091 18:70276530-70276552 ACATGATTACAGTCATAATAAGG + Intergenic
1159651996 18:70988537-70988559 ACATGACTTCTGTCTTCACATGG + Intergenic
925802280 2:7613203-7613225 CCATGAGGTCTGTCATCAGACGG + Intergenic
926913005 2:17868932-17868954 ACATGAAGTCAGTCAGCACAAGG + Intergenic
928256499 2:29727396-29727418 AAATGAGTTCAGTCATGGTGAGG - Intronic
937633276 2:124127281-124127303 ATGTGAGTTCACTCATGATATGG - Intronic
938778690 2:134564492-134564514 ACATAAATGCATTCATCATAAGG + Intronic
940108353 2:150123794-150123816 ACATGGGTTTAGTCAATATATGG + Intergenic
944520614 2:200562827-200562849 TCATGAGTTCACTCATGATTTGG + Intronic
945453333 2:210018615-210018637 ATATGAGCTCACTCATCATCTGG - Intronic
1171561539 20:26131157-26131179 ACATGACTTCAGTAATCTTTGGG - Intergenic
1171739525 20:28863264-28863286 TGATGAGTGCATTCATCATAGGG + Intergenic
1174773340 20:53321838-53321860 ACATGAGATCAGGCATCACCGGG - Intronic
1176649713 21:9534145-9534167 ACATGACTTCAGTGATCTTTGGG + Intergenic
1181119400 22:20655618-20655640 ACATGACTTCAGTAATCTTTGGG - Intergenic
1181385558 22:22542937-22542959 ACATTAATTCATTCATCATAAGG - Intergenic
1181745177 22:24951174-24951196 TCTTGAGTACAGTCATCAAAAGG - Intergenic
950167705 3:10814306-10814328 ACATGAGTTCTGACCTCACAGGG - Intergenic
951867851 3:27327373-27327395 GCATAAGTTCAGTCATAAGAGGG - Intronic
952071739 3:29645531-29645553 ACTTTAGTTAAGTCATCATGAGG + Intronic
952111193 3:30125365-30125387 ACAGGAGTTCACTCATGATTTGG + Intergenic
955651503 3:61199137-61199159 ACATGGGTTTAGTCATGATTTGG - Intronic
956417111 3:69043933-69043955 ACATGAGTTCAATTCTCAAAAGG + Intronic
957725466 3:84059915-84059937 TCAGGAGTTCACTCATCATGGGG + Intergenic
958211680 3:90488725-90488747 ACTTGAGTGCAGACATCACAAGG + Intergenic
958484919 3:94693091-94693113 ACATGAGTTCAAGAATCACATGG - Intergenic
958688800 3:97433873-97433895 ACATGAGAACAGTCATCAGATGG + Intronic
959248132 3:103902017-103902039 ACATGATTGCAGTCATGATACGG + Intergenic
961924213 3:130459973-130459995 ACATGCATTCATTCATCAAAAGG - Intronic
963369006 3:144374021-144374043 ACATGATCTCAATCATTATATGG - Intergenic
963569665 3:146977160-146977182 ACACTATTTCAGTCATCATGTGG + Intergenic
969799504 4:9551857-9551879 ACTTGAGTTCAGTCAACTGAGGG - Intergenic
973060136 4:45713765-45713787 ACATGAGTTCAGTAATGAAATGG + Intergenic
974689220 4:65273379-65273401 ACGTGAGTTCACTCATGATTTGG + Intergenic
975881904 4:78919745-78919767 ACAAGAATTCAGTTATTATATGG + Exonic
979130084 4:117033159-117033181 ACAAGAGTTCATTCATGATTTGG + Intergenic
979572428 4:122243771-122243793 GCATGTGTTCACTCATCTTAAGG + Intronic
982377963 4:154715382-154715404 ACAAGAATTCAGTCATTATCAGG - Intronic
983746744 4:171210110-171210132 ACATGAGTTCATTCATGATTTGG + Intergenic
983772475 4:171569246-171569268 ACATGAACTCAGACATCATTAGG - Intergenic
985364611 4:189215171-189215193 ACATGAGTGCAGTCAAAAGACGG - Intergenic
986675584 5:10181977-10181999 ACAGGAGTTCACTCATTATTTGG - Intergenic
989833904 5:45959321-45959343 AGATGAATTCAAACATCATAAGG - Intergenic
993131480 5:83903828-83903850 ATGGGAGTTCAGTCATCATTTGG + Intergenic
994006949 5:94848613-94848635 AAATTAATTCAATCATCATAAGG - Intronic
995486167 5:112642073-112642095 ACATGACATGAGTCTTCATAAGG - Intergenic
996830132 5:127731237-127731259 ACAGGAGTTCATTCATGATTTGG - Intergenic
997695928 5:135860710-135860732 ACATGAGCACAGTCAACACATGG - Intronic
999385367 5:151150545-151150567 AGCTGAGGACAGTCATCATATGG + Intronic
999688770 5:154126892-154126914 TCATGAGTTCACTCATGATTTGG - Intronic
1003169019 6:3705876-3705898 ACATTAGTTCAGGCAGCAGAAGG + Intergenic
1005775345 6:29125237-29125259 ACATGACTTCAGTCTTTTTATGG + Intergenic
1005781410 6:29196463-29196485 ACATGATTTCAGTCTTTTTATGG + Intergenic
1009246675 6:61247068-61247090 AAATGAGTTCATTCATAATTTGG - Intergenic
1009254930 6:61376143-61376165 AGTTGAGTGCAGACATCATAAGG - Intergenic
1010363478 6:75022496-75022518 ACATGAGTTATGTTATCACAGGG + Intergenic
1010457929 6:76080675-76080697 ACATAACTTCATTCTTCATATGG - Intergenic
1012889306 6:104880667-104880689 ATGTGAGATCAGTCAGCATAGGG + Intergenic
1014038897 6:116800583-116800605 AAATGAGTTCAGGAATCTTAAGG - Exonic
1014306505 6:119749125-119749147 ACATGATTTCATTCTTCTTATGG + Intergenic
1014625679 6:123721681-123721703 ACATGGGTTTAGTAATCAAAGGG + Intergenic
1015284307 6:131467743-131467765 ACATGAATTCATTCATTTTATGG - Intergenic
1015458850 6:133464538-133464560 ACATGGGAACAGTCTTCATAAGG - Intronic
1016032689 6:139354357-139354379 ACATGTCTTCAGCCAGCATATGG - Intergenic
1020674160 7:11160229-11160251 ACATGATTTCATTCTTCTTAAGG + Intronic
1020731286 7:11884041-11884063 ACATGTGGTCAACCATCATATGG + Intergenic
1020845900 7:13283181-13283203 CTATAATTTCAGTCATCATAAGG - Intergenic
1023167512 7:37357321-37357343 ACCTGTGTTCAACCATCATATGG - Intronic
1024846668 7:53652399-53652421 ACAGGAGTTCACTCATGATTTGG - Intergenic
1025316676 7:58039861-58039883 ACTTGAATTCAATCATCAAATGG + Intergenic
1025522042 7:61747634-61747656 AGATGAATGCAGTCATCAAAAGG + Intergenic
1025522976 7:61764098-61764120 ACATGAATGCACTCATCACAAGG + Intergenic
1025545771 7:62165750-62165772 AGATGAATGCAGTCATCAAAAGG + Intergenic
1025546729 7:62183125-62183147 ACATGAATGCACTCATCACAAGG + Intergenic
1025587271 7:62806602-62806624 AGATGAATTTAGACATCATAAGG + Intergenic
1025712294 7:63924471-63924493 ACATGAGTTAATTCATTATGAGG - Intergenic
1027518409 7:79171271-79171293 ACATAACTTCAGTCTTCACAGGG + Intronic
1027519249 7:79182867-79182889 ACATGATTTCATTCATTTTATGG - Intronic
1028536482 7:91893323-91893345 ACATGAATACAGTCAGCATTGGG - Intergenic
1028715354 7:93959756-93959778 ACATGATGTGAGGCATCATATGG - Intergenic
1028892005 7:95998687-95998709 ATAAAAGTACAGTCATCATAAGG - Intronic
1031183473 7:118446286-118446308 CCATGAGTTCAGTCTTCTGATGG - Intergenic
1031398331 7:121301062-121301084 GAATGAGTTTAGTCATCAAATGG + Intergenic
1031828677 7:126599381-126599403 ACATTATCTCAGTTATCATAGGG + Intronic
1033664928 7:143431358-143431380 ACATGAGTCCAGGCAACATGAGG - Intergenic
1038951649 8:32421473-32421495 ACATGACCTCACTCATCATGCGG - Intronic
1039031526 8:33314877-33314899 AGGTGAGTTCAGTGTTCATAGGG + Intergenic
1039332710 8:36556693-36556715 ACATGATTTCATTCATTTTATGG - Intergenic
1039676189 8:39670621-39670643 CCATGAGTACAATAATCATATGG - Intronic
1039923716 8:41910578-41910600 AGATGTGTTCAGTCAGCACACGG - Intergenic
1040823876 8:51596222-51596244 ACATGATTTCATTCTTCTTATGG + Intronic
1044340594 8:91041907-91041929 ACAGGAGTTCAGGCCTCACATGG - Intergenic
1046338523 8:112822421-112822443 ACTGGAGTTCACTCATCATTTGG + Intronic
1047696795 8:127411636-127411658 ACATAGGTTCAGACATCACAAGG + Intergenic
1047884501 8:129234112-129234134 ACATGATTTCACTCATTTTATGG - Intergenic
1051115755 9:13692582-13692604 ACATGTGACCAGTGATCATATGG - Intergenic
1051450999 9:17197172-17197194 ATAAGAGTTCAGTCAGTATATGG + Intronic
1051479808 9:17547345-17547367 ACAGGAGTTCATTCATGATTTGG - Intergenic
1051777645 9:20653784-20653806 ACAGCAGTTCAGTCATCTTTAGG + Intergenic
1051965552 9:22824513-22824535 ACATGAGTTGAAACCTCATAAGG + Intergenic
1052067440 9:24039557-24039579 ACTTGAGTTTAGTCATCATTTGG + Intergenic
1053038411 9:34847369-34847391 ACAGGAGTTCACTCATGATTTGG + Intergenic
1053042024 9:34882585-34882607 ACAGGAGTTCACTCATGATTTGG - Intergenic
1053043642 9:34895390-34895412 AAAGGAGTTCAGCCATCAAATGG + Intergenic
1054788159 9:69229577-69229599 ACATCAGTGCAGTCACCACAGGG - Intronic
1055916125 9:81402013-81402035 ACATGTGTTCTGGCATCAAATGG + Intergenic
1057353299 9:94317562-94317584 ACACGAGTTCAGTCATCATATGG + Intergenic
1057654452 9:96940030-96940052 ACACGAGTTCAGTCATCATATGG - Intronic
1059634748 9:116159826-116159848 ACATGAACTCAGTGATCATCTGG + Intronic
1061265265 9:129501061-129501083 ACAGGAATTCAGTCTTCACAAGG + Intergenic
1203594561 Un_KI270747v1:113732-113754 ACATGAGTACACACATCACAAGG - Intergenic
1203627454 Un_KI270750v1:37693-37715 ACATGACTTCAGTGATCTTTGGG + Intergenic
1185844463 X:3424678-3424700 ACATGACTTCATTCTTCCTATGG + Intergenic
1188271202 X:28143228-28143250 ACATGATTTGATTCATAATATGG - Intergenic
1191891622 X:65949104-65949126 ACATGAGTTCATTCTTCTTATGG + Intergenic
1191975668 X:66868580-66868602 ACTAGAATTCAGTCATCCTAAGG + Intergenic
1193452956 X:81693232-81693254 ACAGGAGTTCATTCATGATTTGG + Intergenic
1194708536 X:97204543-97204565 ATATGAGTTCATTCATGATTTGG - Intronic
1194905290 X:99568297-99568319 ATATGAGTTCACTCGTCATTTGG + Intergenic
1194995928 X:100591437-100591459 GCATGAGCTCAGTCTTCATACGG + Intronic
1195069849 X:101268206-101268228 ATATGAGTACACTCATCATGGGG + Intergenic
1195819166 X:108924341-108924363 ACAATAGTTCTGTCACCATAAGG + Intergenic
1196132327 X:112170519-112170541 ACAAGAGTTCATTCATAATTTGG + Intergenic
1196707608 X:118729101-118729123 ACCTGATTTCCGTAATCATATGG + Intronic
1200297576 X:154937547-154937569 ACATCAGTACAGACATTATAAGG + Intronic
1201417210 Y:13759055-13759077 ACATGATTTCAATCACCTTAAGG + Intergenic
1202013685 Y:20377330-20377352 ACATGACTGCAGTTACCATAGGG - Intergenic