ID: 1067945633

View in Genome Browser
Species Human (GRCh38)
Location 10:50686504-50686526
Sequence ATATGATGACTGAACTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067945621_1067945633 24 Left 1067945621 10:50686457-50686479 CCCTCAAGGTCCTGCATGGAGCC 0: 5
1: 0
2: 1
3: 19
4: 153
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data
1067945623_1067945633 14 Left 1067945623 10:50686467-50686489 CCTGCATGGAGCCCCCCACAGCT 0: 5
1: 0
2: 3
3: 41
4: 251
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data
1067945626_1067945633 1 Left 1067945626 10:50686480-50686502 CCCCACAGCTATGATTCCCTTCC 0: 5
1: 2
2: 2
3: 11
4: 202
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data
1067945627_1067945633 0 Left 1067945627 10:50686481-50686503 CCCACAGCTATGATTCCCTTCCC 0: 7
1: 0
2: 2
3: 19
4: 168
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data
1067945628_1067945633 -1 Left 1067945628 10:50686482-50686504 CCACAGCTATGATTCCCTTCCCA 0: 5
1: 0
2: 1
3: 19
4: 207
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data
1067945622_1067945633 23 Left 1067945622 10:50686458-50686480 CCTCAAGGTCCTGCATGGAGCCC 0: 5
1: 0
2: 0
3: 18
4: 170
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data
1067945624_1067945633 3 Left 1067945624 10:50686478-50686500 CCCCCCACAGCTATGATTCCCTT 0: 5
1: 2
2: 1
3: 19
4: 211
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data
1067945625_1067945633 2 Left 1067945625 10:50686479-50686501 CCCCCACAGCTATGATTCCCTTC 0: 5
1: 2
2: 0
3: 11
4: 160
Right 1067945633 10:50686504-50686526 ATATGATGACTGAACTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067945633 Original CRISPR ATATGATGACTGAACTCATG TGG Intergenic
No off target data available for this crispr