ID: 1067945634

View in Genome Browser
Species Human (GRCh38)
Location 10:50686532-50686554
Sequence ATGTAGACACAGATTTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067945628_1067945634 27 Left 1067945628 10:50686482-50686504 CCACAGCTATGATTCCCTTCCCA 0: 5
1: 0
2: 1
3: 19
4: 207
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data
1067945626_1067945634 29 Left 1067945626 10:50686480-50686502 CCCCACAGCTATGATTCCCTTCC 0: 5
1: 2
2: 2
3: 11
4: 202
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data
1067945629_1067945634 13 Left 1067945629 10:50686496-50686518 CCCTTCCCATATGATGACTGAAC 0: 7
1: 0
2: 0
3: 5
4: 124
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data
1067945627_1067945634 28 Left 1067945627 10:50686481-50686503 CCCACAGCTATGATTCCCTTCCC 0: 7
1: 0
2: 2
3: 19
4: 168
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data
1067945631_1067945634 8 Left 1067945631 10:50686501-50686523 CCCATATGATGACTGAACTCATG 0: 5
1: 2
2: 0
3: 8
4: 101
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data
1067945632_1067945634 7 Left 1067945632 10:50686502-50686524 CCATATGATGACTGAACTCATGT 0: 5
1: 2
2: 0
3: 12
4: 189
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data
1067945625_1067945634 30 Left 1067945625 10:50686479-50686501 CCCCCACAGCTATGATTCCCTTC 0: 5
1: 2
2: 0
3: 11
4: 160
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data
1067945630_1067945634 12 Left 1067945630 10:50686497-50686519 CCTTCCCATATGATGACTGAACT 0: 7
1: 0
2: 1
3: 4
4: 117
Right 1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067945634 Original CRISPR ATGTAGACACAGATTTACAT TGG Intergenic
No off target data available for this crispr