ID: 1067947156

View in Genome Browser
Species Human (GRCh38)
Location 10:50696781-50696803
Sequence GGCAGATGCCCTTGCTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067947156_1067947162 22 Left 1067947156 10:50696781-50696803 CCATCACAGCAAGGGCATCTGCC No data
Right 1067947162 10:50696826-50696848 GAGCCCTCAGCTCTTTGCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067947156 Original CRISPR GGCAGATGCCCTTGCTGTGA TGG (reversed) Intergenic
No off target data available for this crispr