ID: 1067948938

View in Genome Browser
Species Human (GRCh38)
Location 10:50710378-50710400
Sequence GTGGACTAAACAGGAACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067948938_1067948944 -2 Left 1067948938 10:50710378-50710400 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1067948944 10:50710399-50710421 ACAGCAAAGGTGCGGCCGGTTGG No data
1067948938_1067948941 -10 Left 1067948938 10:50710378-50710400 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1067948941 10:50710391-50710413 TTTAGTCCACAGCAAAGGTGCGG No data
1067948938_1067948942 -6 Left 1067948938 10:50710378-50710400 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1067948942 10:50710395-50710417 GTCCACAGCAAAGGTGCGGCCGG No data
1067948938_1067948945 10 Left 1067948938 10:50710378-50710400 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1067948945 10:50710411-50710433 CGGCCGGTTGGAAGAACGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067948938 Original CRISPR GTGGACTAAACAGGAACCAC TGG (reversed) Intergenic
No off target data available for this crispr