ID: 1067957250

View in Genome Browser
Species Human (GRCh38)
Location 10:50805991-50806013
Sequence TAGGAGTTCTAGGGAAAAAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067957250 Original CRISPR TAGGAGTTCTAGGGAAAAAT AGG Exonic
903307031 1:22420202-22420224 AAGGAATTGTGGGGAAAAATTGG - Intergenic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
905758264 1:40531045-40531067 TAGGAGTTGGAGGGAAGGATGGG - Intergenic
907763410 1:57384723-57384745 TGGGAGGTGGAGGGAAAAATGGG + Intronic
908734843 1:67265598-67265620 TAGGTGTACTAGTGAAAAATTGG - Intergenic
909214726 1:72872063-72872085 AGGGAGCTCTAGGGAAACATAGG + Intergenic
909554396 1:76937317-76937339 TAGGACTTATGGGGAAAATTGGG + Intronic
911653884 1:100421032-100421054 TAGGACTTCTTGGCAAAAGTAGG + Intronic
916222287 1:162457054-162457076 TAAGACTTCTAGAGAAAAACAGG + Intergenic
918907019 1:190509727-190509749 TAGGAGTTCAAGGCCAGAATGGG + Intergenic
919422175 1:197383482-197383504 TAGCAGTTCTATTGAAAAAGTGG - Intronic
919591485 1:199509450-199509472 AAGGCGTATTAGGGAAAAATAGG + Intergenic
920691800 1:208152931-208152953 TGGGAGTTCCAAGGAAAGATTGG - Intronic
921659293 1:217780029-217780051 TAGGTATTCTAGGGATTAATTGG + Intronic
923869871 1:237980053-237980075 TAGAAACTCTAGGGAAAAAATGG + Intergenic
924328107 1:242915847-242915869 TATTAGTTCTATGGAAAAATGGG - Intergenic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063322412 10:5062829-5062851 TAGGAGTTCTGTGGAAATAGAGG - Intronic
1064699404 10:18003004-18003026 TATGAATTCTAGAGAAATATAGG + Intronic
1064741194 10:18436506-18436528 TAGGACTTGTAGGTAAAAATTGG + Intronic
1065861432 10:29875700-29875722 TAGGAGATTTAGGGAGAAAACGG - Intergenic
1067511801 10:46902043-46902065 TATGATTTTTAGGGAAAAAAAGG + Intergenic
1067650446 10:48149781-48149803 TATGATTTTTAGGGAAAAAAAGG - Intergenic
1067957250 10:50805991-50806013 TAGGAGTTCTAGGGAAAAATAGG + Exonic
1069101578 10:64329146-64329168 TATCAGGTCTAGGGAAAAATAGG + Intergenic
1070000575 10:72373662-72373684 CAGGACTTCTAGGGAAAAGGGGG + Intronic
1072478037 10:95782482-95782504 TAGTAGTTCCAAGAAAAAATTGG + Intronic
1073585351 10:104704664-104704686 CTAGAGTACTAGGGAAAAATTGG - Intronic
1073678951 10:105680690-105680712 TTGAAGTTCTTGGCAAAAATTGG - Intergenic
1074838229 10:117321476-117321498 GAGGAGTACTAGAGGAAAATGGG + Intronic
1075677971 10:124309271-124309293 TAGGAATTCTAGGGGGAAAGTGG + Intergenic
1078330059 11:10411783-10411805 TAGGATTTCTAATGAAACATGGG - Intronic
1078835994 11:15030466-15030488 TCACAATTCTAGGGAAAAATGGG - Intronic
1079923254 11:26457980-26458002 TAAGAGCTTTTGGGAAAAATAGG + Intronic
1080185263 11:29475703-29475725 TAGGAGTTCTAGGGCAGACGGGG - Intergenic
1086098095 11:83070647-83070669 TAAGAGTTATAGGGATAATTAGG - Intronic
1088475102 11:110228113-110228135 TAGGTCTACTAAGGAAAAATTGG + Intronic
1088761541 11:112933752-112933774 TGGGCATTCTAGGGAAAAAATGG + Intergenic
1089043994 11:115483074-115483096 TAAGAGTTTTAGAGAAAAGTTGG - Intronic
1091808478 12:3375214-3375236 TAGTGGTTCTAGTGAAAAAGAGG - Intergenic
1092210465 12:6643041-6643063 CAGGAGTTCTAGACAAACATGGG + Intronic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1093868054 12:24252219-24252241 TATCAGTTCTATGGAAAATTAGG + Intergenic
1095341508 12:41094697-41094719 CAGGAGAACTAGGAAAAAATGGG - Intergenic
1096840435 12:54376556-54376578 TAGGAGCTCTAGTGAATCATGGG + Intronic
1096910857 12:54982377-54982399 TAGGAGTTCTATTGACTAATGGG - Intronic
1097574216 12:61371445-61371467 TTGAGGTTCTAAGGAAAAATAGG - Intergenic
1097653112 12:62327818-62327840 TAGTAGATCCAGTGAAAAATAGG - Intronic
1098262924 12:68689579-68689601 TAGGAGTTCGAGGGATAACCTGG - Exonic
1098646617 12:72909901-72909923 AAGGTGTTATAGAGAAAAATTGG + Intergenic
1099369220 12:81810029-81810051 TATTACTTCTAGGGAAAAAAAGG + Intergenic
1100091902 12:90983351-90983373 TCTGAATTCTAAGGAAAAATAGG - Intronic
1101084661 12:101223444-101223466 TAGGAATTCTAGAGAAAGAGTGG + Intergenic
1101905365 12:108820776-108820798 TGGTAATTCTAGGGAAAAAAAGG + Intronic
1104289880 12:127456896-127456918 TTGGAGCTCCAGGGAGAAATAGG - Intergenic
1105893703 13:24700311-24700333 GATGATTTCTAGGGAAAAAAGGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1109198570 13:59406390-59406412 TGGGAGTTCTAAGGGACAATTGG + Intergenic
1109832843 13:67814593-67814615 TAGGAGTTGTAGGGAGAAAAAGG + Intergenic
1116626592 14:47272591-47272613 CTGGAGTACTAGGGAAAAAGTGG - Intronic
1118994871 14:70826691-70826713 GAGCAGTTCTTGGGAAAAAGGGG - Intergenic
1120311082 14:82829290-82829312 TAAGTGTTCTAGGAACAAATTGG + Intergenic
1120322919 14:82988643-82988665 TCTGAGTTCGAGGGACAAATAGG - Intergenic
1120621187 14:86766707-86766729 CAGGAGTACAAGAGAAAAATTGG + Intergenic
1121162243 14:91754492-91754514 GAGGTGTTCTCAGGAAAAATTGG - Intronic
1123663985 15:22592247-22592269 TAGGTGGTATAGGGATAAATAGG + Intergenic
1124317815 15:28686688-28686710 TAGGTGGTATAGGGATAAATAGG + Intergenic
1124565620 15:30810794-30810816 TAGGTGGTATAGGGATAAATAGG - Intergenic
1125997888 15:44181827-44181849 CAGGAGTTCGAGGGTAAAGTGGG + Intronic
1126333794 15:47564652-47564674 GAGGAATTCTAGGGAGAAAAGGG + Intronic
1126477043 15:49076592-49076614 TTTGAGTTCTGGGGAAAATTAGG - Intergenic
1129630256 15:77251168-77251190 TAGGATTTCAAGTAAAAAATTGG + Intronic
1129909870 15:79217988-79218010 TAGCAGTTCTAAGTTAAAATAGG + Intergenic
1130241006 15:82191147-82191169 TAGTATTTGTAGGGAAAAGTAGG - Intronic
1131334377 15:91533537-91533559 TATGAATTCAAGTGAAAAATCGG + Intergenic
1131566887 15:93493970-93493992 TATTAGTTCTATGGGAAAATTGG + Intergenic
1131957984 15:97758140-97758162 TAAGAGTTCTAGGGAAAAACCGG - Intergenic
1134788013 16:16962549-16962571 TAGGAGTTTTACGGAGAATTGGG + Intergenic
1135927224 16:26706034-26706056 TAACAGTTCTATGGAACAATCGG + Intergenic
1140520200 16:75574524-75574546 GAGGAGTTTCAGAGAAAAATGGG + Intronic
1141866346 16:86752608-86752630 TAGGAGCCTTAAGGAAAAATGGG - Intergenic
1146983791 17:37192585-37192607 TAGGAGTTCTAAGGAAATTGAGG - Intronic
1147760472 17:42794866-42794888 TGGGGGTTCCAGGGGAAAATGGG - Exonic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1152412051 17:80131372-80131394 TAGCAAGTCTAAGGAAAAATAGG - Intergenic
1152872858 17:82767314-82767336 TAGAAGTACTAGGGAAAGAAGGG - Intronic
1154264649 18:12869625-12869647 TAGCAGTTCGAGGGAGAATTTGG - Intronic
1156178512 18:34575820-34575842 TAGACTTTCTAGGGGAAAATGGG - Intronic
1158084778 18:53638276-53638298 GAGGAGTTCTAAGGCGAAATGGG - Intergenic
1160097872 18:75891700-75891722 TAGGAGATGCAGGGAAACATTGG + Intergenic
1163867672 19:19787818-19787840 TAGGAGGTCAAAGGATAAATGGG - Intronic
1166761182 19:45225152-45225174 TAGGAGGTCTAGGGTATATTGGG + Intronic
1167032441 19:46971938-46971960 CAGCAGTTCTAGGAAAAACTGGG - Intronic
925871081 2:8271235-8271257 TAGGTATTCTATGGAAGAATAGG + Intergenic
926024198 2:9525910-9525932 TATTAGTTCAAGGGTAAAATGGG + Intronic
926594554 2:14776161-14776183 TAAAAGTTCTAGGGAAAAAATGG + Intergenic
927693059 2:25221950-25221972 TAGGAAGCCTAGGGAAAAAGGGG + Intergenic
933025378 2:77251377-77251399 TAGGAGTTCCAGGGAAATGGAGG + Intronic
937912690 2:127083286-127083308 TAGGAGTTCCAGACAAAACTGGG - Intronic
939285448 2:140123284-140123306 TAAGTGTTCTAGACAAAAATAGG - Intergenic
939621522 2:144425130-144425152 TGGCAGTTCTAGTGACAAATGGG + Intronic
942629524 2:177940544-177940566 TAGGAGTGCAATGGACAAATAGG - Intronic
942841121 2:180362019-180362041 GCTAAGTTCTAGGGAAAAATAGG - Intergenic
944892615 2:204133382-204133404 TAGGAGTAGTAGGGAAAACATGG - Intergenic
945797615 2:214384336-214384358 TAGCATCTCTAGGGAAAAATGGG - Intronic
946570031 2:221014308-221014330 TAGGAGTTTTAGGGATAACTTGG - Intergenic
946939093 2:224752353-224752375 CATTAGTTCTATGGAAAAATTGG + Intergenic
948655398 2:239473717-239473739 TTGGGGGTCTTGGGAAAAATGGG + Intergenic
1169575232 20:6952493-6952515 TAGGAGTTCTCAGCAAAAACTGG + Intergenic
1169765846 20:9147155-9147177 TTGGAGGTCTATGGTAAAATAGG + Intronic
1169781069 20:9311190-9311212 TAGGAATTCTAGGAAAGACTGGG - Intronic
1174299266 20:49569598-49569620 TGGGACCTCTAGGGAAAGATGGG - Intergenic
1175094555 20:56531145-56531167 TAGGAGTTGGTGGGTAAAATGGG - Intergenic
1178627151 21:34227680-34227702 TTGGACTCCCAGGGAAAAATAGG - Intergenic
1181834862 22:25596098-25596120 TAGGAATTGTATGGAAAAACTGG + Intronic
949097719 3:105918-105940 TAAGAGTGATAGGGAAAAAAAGG - Intergenic
949449258 3:4166987-4167009 TCCGAATTCTAAGGAAAAATAGG + Intronic
950402800 3:12783043-12783065 TAGGAGTTATAGTGAAACAAGGG + Intergenic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
952315770 3:32230989-32231011 TAGGAGTTCTGTGGAATGATGGG - Intergenic
952552129 3:34490917-34490939 TAGGAGAAGTAGGGAAACATGGG + Intergenic
953371355 3:42391241-42391263 TTGGAGTTTGAGGGAAATATTGG + Intergenic
953586245 3:44203636-44203658 TAGGAGATGAAGGTAAAAATTGG + Intergenic
957000308 3:74876653-74876675 TAGAAGTACTAAGGAAAACTAGG - Intergenic
957977740 3:87469273-87469295 TTGGAATTCTAGGTGAAAATTGG - Intergenic
958016290 3:87943052-87943074 TAGGAGGACTAAGGAAAACTAGG - Intergenic
958576082 3:95950922-95950944 CCGGAATTCTAAGGAAAAATAGG + Intergenic
959572284 3:107897616-107897638 TAGGATTTCTAAGAGAAAATGGG - Intergenic
960348203 3:116561037-116561059 AAGGATTGCTAGGGAAAAAGAGG - Intronic
960849210 3:122035033-122035055 TAGGAGCTCAAGAGAAAAATTGG + Intergenic
961605225 3:128089202-128089224 TAAGGGTTCAAGAGAAAAATAGG - Intronic
962331561 3:134483612-134483634 TAGCAGTTTCAGAGAAAAATGGG - Intronic
963017183 3:140836232-140836254 TAGCAGTTATAAGGAAAAATAGG + Intergenic
963103883 3:141629139-141629161 TAGGAGTTTTAAGGATAAGTTGG + Intergenic
963618927 3:147579834-147579856 TACGATTTCTTGGGATAAATTGG + Intergenic
964648367 3:158983745-158983767 TAGCAGTGCTAGTGAAAAATTGG + Intronic
964672303 3:159240084-159240106 TAGGAAGTGTAGGGGAAAATAGG + Intronic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
965151592 3:164983799-164983821 TAGGAGTTCTAGACAAACCTGGG - Intronic
965338544 3:167457890-167457912 TAGAAGTTTTATAGAAAAATAGG + Intronic
965732266 3:171784657-171784679 TAGGATGTCTATGGAAAGATTGG - Intronic
967724918 3:192852758-192852780 TGAAAGTTCTAGGGCAAAATTGG - Intronic
969668951 4:8579185-8579207 TGGGAGTGCCAGGGAGAAATGGG + Intronic
971283900 4:25268356-25268378 TAGGAGTTGTAGGAAAGAACCGG + Intronic
973241980 4:47966926-47966948 TAAGAGTTCTAGTTATAAATGGG - Intronic
975211633 4:71707274-71707296 TGGAAGCTCTAGGGAAGAATAGG - Intergenic
976199623 4:82565194-82565216 TAGGAGTTCTTGGGAACAGGGGG - Intergenic
976485059 4:85592100-85592122 AAGGAGTGCTAGGACAAAATAGG - Intronic
976629533 4:87222288-87222310 AAGGACTTTTAGGGGAAAATGGG - Intronic
976749513 4:88440079-88440101 TAGAAGTTGTTCGGAAAAATTGG - Intronic
977354155 4:95924795-95924817 AAGGACTTCAATGGAAAAATAGG + Intergenic
977434835 4:96980886-96980908 TTGGAGATGTAGGGAAAAAAAGG + Intergenic
977909609 4:102517685-102517707 TAGGATTTCTTGGCAGAAATTGG + Intronic
977922092 4:102656917-102656939 GAGGAGGGATAGGGAAAAATAGG + Intronic
978348389 4:107795991-107796013 TTAGAGATCTAGGGAGAAATCGG + Intergenic
979472470 4:121115973-121115995 TAAGAGTAATGGGGAAAAATAGG + Intergenic
980720882 4:136694090-136694112 TATGAGTTCTCTGGAAAAAGTGG + Intergenic
981335148 4:143561044-143561066 TAGCAGTGCTAAGGCAAAATAGG + Intergenic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
983592534 4:169429812-169429834 CAGAAGTCCAAGGGAAAAATGGG - Intronic
984270901 4:177547702-177547724 TATCAGTTCTATGGGAAAATTGG + Intergenic
984541177 4:181039466-181039488 TAAGATTTCTAGGAAAAAAAAGG + Intergenic
985912654 5:2895972-2895994 TAGGATTTCCAGGGAAGAAGAGG - Intergenic
986048793 5:4067399-4067421 TATGAGCTCTATGGAAACATAGG + Intergenic
987364806 5:17139503-17139525 CAAGAATTTTAGGGAAAAATTGG - Intronic
988010680 5:25478735-25478757 ATGGAGTTCAAGGGAAAAAAAGG - Intergenic
988695951 5:33623039-33623061 TATGATTACTAGGGAACAATAGG + Intronic
988776774 5:34484151-34484173 TTAAAGTTCTGGGGAAAAATTGG - Intergenic
989419807 5:41224397-41224419 GAGGAGGGATAGGGAAAAATAGG - Intronic
992216901 5:74534606-74534628 TAGGAGTTCAAGAATAAAATAGG + Intergenic
994239131 5:97399708-97399730 TAGGGGTTTTAGGGACAATTTGG - Intergenic
994301317 5:98151442-98151464 CAAGAATTCTAGAGAAAAATAGG - Intergenic
994907211 5:105856546-105856568 TAATAGTTCTAGGGAATAAATGG - Intergenic
996680075 5:126221927-126221949 TCCGAATTCTAAGGAAAAATAGG - Intergenic
997761679 5:136454609-136454631 TAGGACTTCTATGGAGTAATTGG - Intergenic
1000531092 5:162420966-162420988 TAAGAGTTAAAGGGAACAATTGG + Intergenic
1000639599 5:163685948-163685970 TTGGAGGACTAGGGAGAAATTGG - Intergenic
1002973986 6:2055572-2055594 TATGAGGTTAAGGGAAAAATTGG - Intronic
1006322173 6:33326091-33326113 TAGGAGCTCAAGGAAAAAAGAGG + Intronic
1007040942 6:38721724-38721746 TATGAGTTCTCTGGAAAACTTGG + Intronic
1007211401 6:40195873-40195895 TAGGAGTTCCAGGGAAGCACAGG - Intergenic
1009044426 6:58220917-58220939 TATCAGTTCTATGGAGAAATTGG - Intergenic
1009220250 6:60975163-60975185 TATCAGTTCTATGGAGAAATTGG - Intergenic
1009229668 6:61046810-61046832 TAAGAGTACTAAGGAATAATCGG - Intergenic
1010581688 6:77606879-77606901 CAGGAGTTGTCGGGGAAAATAGG - Intergenic
1011516821 6:88164580-88164602 GAGGAGTACCAGGGAAAAAAAGG + Intronic
1012222440 6:96665133-96665155 TTTCAGTTCTATGGAAAAATTGG + Intergenic
1012520037 6:100110340-100110362 TAGGAAATATAGGAAAAAATGGG - Intergenic
1012947762 6:105486197-105486219 TAAGAGTTCAGGGGAGAAATTGG + Intergenic
1013857655 6:114593408-114593430 TAAGTGCTCTAGGGAAAAAGCGG + Intergenic
1017004234 6:150018965-150018987 TTGGGGCTCAAGGGAAAAATAGG - Intronic
1017369655 6:153690225-153690247 TAAGAGTTCTATGGAACAATTGG - Intergenic
1018519587 6:164632542-164632564 TAGGAGTTCAACAGAAAAGTAGG + Intergenic
1019304084 7:324318-324340 TGGGAGGTCCAGGGAAAGATGGG - Intergenic
1020267060 7:6567974-6567996 TAGGAGGTATAGGGACAAAAAGG - Intergenic
1020629214 7:10620404-10620426 AAGTAGTTGTAGGGAAACATCGG + Intergenic
1020845721 7:13279756-13279778 TAAAAGTTGTAGGAAAAAATGGG - Intergenic
1021757031 7:23861523-23861545 TCCGAATTCTAAGGAAAAATAGG + Intergenic
1022569834 7:31441481-31441503 TAGATTTTCTAGGGAGAAATGGG + Intergenic
1023427184 7:40050304-40050326 TAGAAGTTGAAAGGAAAAATTGG + Intronic
1024013656 7:45292140-45292162 TAGGAATTCAGGGGAAAAAAAGG + Intergenic
1024396991 7:48880861-48880883 TAGAAGTGCCAGGGAAAAACAGG - Intergenic
1025189573 7:56886379-56886401 TAGGAGTTCAAGGCAAACCTGGG + Intergenic
1025682367 7:63690538-63690560 TAGGAGTTCAAGGCAAACCTGGG - Intergenic
1026728979 7:72894831-72894853 TAAAAGTTTTAGGTAAAAATGGG + Intronic
1027441130 7:78220197-78220219 TAGGAGTTCTAGGTAGAAATGGG - Intronic
1028095615 7:86756507-86756529 TTGAAGTTCTGGGGAAAAACTGG - Intronic
1030401257 7:109053472-109053494 AAGGAGTTCTAGGAAATAAATGG - Intergenic
1030696910 7:112595472-112595494 TGAGGCTTCTAGGGAAAAATTGG - Intergenic
1031192285 7:118568463-118568485 TAGGGGTTCTAAGGAAATTTTGG + Intergenic
1031287834 7:119894458-119894480 TAGGAGATCAAGAGAAACATTGG - Intergenic
1032542054 7:132711293-132711315 TAGTCATTCTAGGAAAAAATCGG - Intronic
1033759573 7:144424294-144424316 CCGGAATTCTAAGGAAAAATAGG + Intergenic
1034476727 7:151288939-151288961 GAGGAGTTGGAGGGAGAAATGGG + Intergenic
1035302483 7:157906550-157906572 TAGGTATTCTATGAAAAAATGGG + Intronic
1035681166 8:1489233-1489255 TTGGAGTTCGTGGAAAAAATGGG + Intergenic
1039664717 8:39512312-39512334 TAGGAGTTTTAGGGGAAAAAAGG - Intergenic
1040578896 8:48678957-48678979 TAGGAGTTATATGTAAAAACTGG + Intergenic
1041642331 8:60216801-60216823 AAGGAATTCTAGGTAGAAATGGG + Intronic
1042067310 8:64892433-64892455 TAGGAGTTCAAGGTTACAATGGG - Intergenic
1043496368 8:80805231-80805253 TAGAAGTGCTAGGGAAAAGCAGG - Intronic
1044232548 8:89796151-89796173 TAGGAGTCCTAGTGAGAAAAAGG - Intergenic
1045162805 8:99568133-99568155 GAGGAGTTTTAGGGAGAAAAGGG + Intronic
1047012177 8:120684574-120684596 TAGGAGAGAAAGGGAAAAATAGG + Intronic
1047769191 8:128016975-128016997 CAGGAGTTCAAGGCAAAACTGGG + Intergenic
1048588841 8:135802423-135802445 GAGGATTTCCAGGGAAAAAACGG - Intergenic
1050498818 9:6272659-6272681 TGATAGTTCCAGGGAAAAATAGG - Intergenic
1054967939 9:71051058-71051080 GAGGAGTTCTAGGGGAAAAGAGG + Intronic
1059263183 9:112999330-112999352 TATGAGTTATAGAGAAGAATAGG - Intergenic
1059813830 9:117888663-117888685 TAGGAGCTCTAGGCTGAAATCGG + Intergenic
1060429340 9:123535914-123535936 TAGGATTTCTAAGGAAAAATTGG + Intronic
1187739011 X:22334889-22334911 TAAGAGTATTAGGGGAAAATTGG - Intergenic
1191879098 X:65826819-65826841 CAGGAGATATAGGGAAAACTGGG + Intergenic
1191916835 X:66210472-66210494 GAGGAGATCTAGGGACTAATAGG + Intronic
1192739584 X:73880019-73880041 TAGGAGTTCAACTGAAAAGTTGG - Intergenic
1193492983 X:82172303-82172325 TAGCAATACTATGGAAAAATTGG + Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195119278 X:101733840-101733862 TAGAAGTCCTAGGGAAAATGTGG + Intergenic
1196036883 X:111155290-111155312 TAGGAGTTCAAGAGCAAACTGGG + Intronic
1196883035 X:120216791-120216813 TAGTCTTTCTGGGGAAAAATTGG + Intergenic
1199251054 X:145662116-145662138 CAGCAGTTCTGGGGAAACATTGG + Intergenic
1199832738 X:151561588-151561610 TCCGAATTCTAAGGAAAAATAGG + Intergenic
1200170088 X:154066318-154066340 CAGGAGTTCTAGGCCAACATAGG - Intronic
1200312585 X:155093760-155093782 TAGGAGTTCTAGAAAAAGAAAGG - Intronic
1200966462 Y:9043792-9043814 TCTGAATTCTAAGGAAAAATAGG - Intergenic
1201225503 Y:11814812-11814834 TATTAGTTCTATGGAAAAATGGG - Intergenic
1201910827 Y:19132142-19132164 CCTGAGTTCTAAGGAAAAATAGG - Intergenic