ID: 1067957733

View in Genome Browser
Species Human (GRCh38)
Location 10:50810896-50810918
Sequence CAAATATTGAGATGTGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 572}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067957733_1067957735 28 Left 1067957733 10:50810896-50810918 CCAACTACACATCTCAATATTTG 0: 1
1: 0
2: 1
3: 52
4: 572
Right 1067957735 10:50810947-50810969 ACCTCAGTATCTTGTTTAGATGG 0: 1
1: 0
2: 1
3: 21
4: 388
1067957733_1067957734 -1 Left 1067957733 10:50810896-50810918 CCAACTACACATCTCAATATTTG 0: 1
1: 0
2: 1
3: 52
4: 572
Right 1067957734 10:50810918-50810940 GCATTGAATGACAAATGAGTAGG 0: 1
1: 0
2: 0
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067957733 Original CRISPR CAAATATTGAGATGTGTAGT TGG (reversed) Intronic
901032532 1:6315875-6315897 CACATGTTAAGATGTGTATTAGG - Intronic
901157578 1:7150704-7150726 CAAGTATTGGGATGTGCAGAAGG + Intronic
902965445 1:19997833-19997855 GAAATATAGAGGTGTGAAGTGGG - Intergenic
902966058 1:20003637-20003659 GAAATATAGAGATGTGAAGTGGG - Intergenic
904124406 1:28226835-28226857 CAAATATTGATATCTGATGTTGG - Intronic
904572921 1:31480793-31480815 GAAATATAGAGGTGTGAAGTGGG - Intergenic
904574215 1:31492516-31492538 GAAATATAGAGGTGTGAAGTGGG + Intergenic
905843256 1:41203933-41203955 GAAATATAGAGGTGTGAAGTGGG - Intronic
906008859 1:42503928-42503950 GAAATATAGAGGTGTGAAGTGGG + Intronic
906379358 1:45322496-45322518 GAAATATAGAGGTGTGAAGTGGG - Intergenic
906774126 1:48513313-48513335 GAAATATAGAGGTGTGAAGTGGG + Intergenic
906774837 1:48519812-48519834 GAAATATAGAGGTGTGAAGTGGG + Intergenic
906840692 1:49135448-49135470 GAAATATAGAGGTGTGAAGTGGG + Intronic
907201306 1:52728947-52728969 CAAGAATGGAGATGTGTAGTAGG + Intronic
907465225 1:54630686-54630708 GAAATATAGAGGTGTGAAGTGGG - Intronic
907798812 1:57743743-57743765 GAAATATAGAGGTGTGAAGTGGG + Intronic
908369805 1:63470213-63470235 GAAATATAGAGGTGTGAAGTGGG - Intronic
909098115 1:71315406-71315428 GAAATATAGAGGTGTGAAGTGGG + Intergenic
909208479 1:72791670-72791692 GAAATACAGAGATGTGAAGTGGG + Intergenic
909576053 1:77177647-77177669 GAAATATAGAGGTGTGGAGTGGG - Intronic
909769978 1:79409632-79409654 CAAATATTCAAATTTGTATTAGG + Intergenic
910151993 1:84159826-84159848 CATATATTGAGATGATTATTTGG + Intronic
911020835 1:93386247-93386269 GAAATATAGAGGTGTGAAGTGGG + Intergenic
911283443 1:95959676-95959698 GAAATATAGAGGTGTGAAGTGGG - Intergenic
911785432 1:101940605-101940627 CAAATATGGGTATGTGTGGTGGG + Intronic
912856572 1:113173546-113173568 GAAATATAGAGGTGTGGAGTGGG - Intergenic
912933785 1:113985668-113985690 GAAATATAGAGGTGTGGAGTGGG + Intergenic
913965277 1:143371924-143371946 GAAATAGAGAGTTGTGTAGTGGG - Intergenic
914059653 1:144197526-144197548 GAAATAGAGAGTTGTGTAGTGGG - Intergenic
914119497 1:144768845-144768867 GAAATAGAGAGTTGTGTAGTGGG + Intergenic
914332516 1:146685377-146685399 CAACTATTGAAAACTGTAGTTGG - Intergenic
914981792 1:152421294-152421316 GAAATATAGAGGTGTGGAGTGGG + Intergenic
914982134 1:152424239-152424261 GAAATATAGAGTTGTGAAGTGGG + Intergenic
915261498 1:154679819-154679841 GAAATATAGAGGTGTGAAGTGGG - Intergenic
915379684 1:155428918-155428940 GAAATATAGAGGTGTGAAGTGGG - Intronic
915810138 1:158900366-158900388 CAAATATAGAGGTGTGAAGTGGG + Intergenic
915883269 1:159696349-159696371 CAAATATTTAGTTTTGTAGATGG + Intergenic
916264090 1:162872721-162872743 CAAATATTTAGATGGGTACATGG - Intergenic
916388612 1:164305462-164305484 CAATTATTGAGAAGGGAAGTGGG + Intergenic
916753563 1:167745802-167745824 CAATTATTGAGATGTGTTATAGG + Intronic
917293306 1:173493510-173493532 GAAATATAGAGGTGTGGAGTGGG - Intergenic
917799119 1:178554142-178554164 GAAATATAGAGGTGTGAAGTGGG + Intergenic
917799764 1:178560037-178560059 GAAATATAGAGGTGTGAAGTGGG + Intergenic
918142497 1:181731389-181731411 CAAATGTTGAGAGGTGCAGAGGG - Intronic
918234966 1:182571648-182571670 GAAATATAGAGGTGTGGAGTGGG - Intergenic
918837611 1:189488078-189488100 GAAATATAGAGGTGTGGAGTGGG + Intergenic
918994874 1:191744397-191744419 GAAATATTGAGTTGTTTAGAGGG + Intergenic
919200799 1:194352966-194352988 GAAATATAGAGGTGTGAAGTGGG - Intergenic
919282606 1:195510411-195510433 GAAATATAGAGGTGTGAAGTGGG - Intergenic
919515307 1:198514956-198514978 CATATATTGGGGTGTGAAGTAGG + Intergenic
919593956 1:199538409-199538431 GAAATATAGAGGTGTGAAGTGGG + Intergenic
920085730 1:203414888-203414910 GAAATATAGAGGTGTGAAGTGGG - Intergenic
920086271 1:203419890-203419912 CAAATATGGAGGTGGGTAGATGG + Intergenic
920412998 1:205776832-205776854 GAAATATAGAGGTGTGAAGTGGG + Intergenic
921226503 1:213025548-213025570 GAAATATAGAGGTGTGAAGTGGG + Intergenic
921227197 1:213031998-213032020 TAAATATAGAGGTGTGAAGTGGG + Intergenic
921875617 1:220192244-220192266 CAGATACTGAGACATGTAGTAGG + Intronic
923847282 1:237748803-237748825 CGAATATTTAAATCTGTAGTTGG - Intronic
923861058 1:237892495-237892517 CAAATATAGAGGTGTAGAGTGGG + Intergenic
924274251 1:242369233-242369255 AAAATATTGAGAACTGTAATGGG + Intronic
924765677 1:247030084-247030106 CAAATATAGAGGTGTGAAGTGGG - Intergenic
1063314278 10:4986200-4986222 GAAATATAGAGGTGTGAAGTGGG + Intronic
1063789217 10:9423126-9423148 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1064489576 10:15837912-15837934 CAAATATGAAGATTTCTAGTAGG - Intronic
1065609673 10:27460515-27460537 AAAATATAGAGAAGTGAAGTAGG - Intergenic
1066312987 10:34216173-34216195 CAAATATTGAGCTGGGTAGCAGG - Intronic
1066329280 10:34401211-34401233 TAAATATTGACATGTGTAAATGG - Intronic
1066619330 10:37327163-37327185 TAAATATAGAGGTGTGGAGTGGG - Intronic
1066801519 10:39197808-39197830 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1067135175 10:43601563-43601585 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1067233872 10:44430914-44430936 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1067957733 10:50810896-50810918 CAAATATTGAGATGTGTAGTTGG - Intronic
1068075417 10:52247858-52247880 GAAATATAGAGGTGTGAAGTGGG + Intronic
1068140888 10:53005650-53005672 TAAAAATTTAGATGTGTAGTAGG + Intergenic
1068166171 10:53335667-53335689 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1068166909 10:53342463-53342485 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1068177832 10:53485222-53485244 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1068217556 10:54002670-54002692 CCAATAGTGAGGTGTGGAGTTGG + Intronic
1068445671 10:57119386-57119408 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1068671168 10:59725124-59725146 GAAATATAGAGGTGTGGAGTGGG + Intronic
1068674871 10:59760365-59760387 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1069070204 10:63984472-63984494 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1069172107 10:65245254-65245276 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1071198228 10:83186814-83186836 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1071375161 10:84994997-84995019 CACAGATTGAGAAGTGGAGTCGG + Intergenic
1072841534 10:98779592-98779614 CAAATATTAACATGTATTGTTGG + Intronic
1074032148 10:109699716-109699738 CTAATATTGAGAGGTGAAGCCGG + Intergenic
1074980434 10:118615299-118615321 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1075014088 10:118897378-118897400 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1076232275 10:128831329-128831351 CAAATTTTGATATGTGCAGGGGG - Intergenic
1076416191 10:130291232-130291254 GAAATATAGAGATGTGGAGTGGG - Intergenic
1076416897 10:130297699-130297721 GAAATATAGAGATGTGGAGTGGG - Intergenic
1077180492 11:1210428-1210450 GAAATATAGAGATGTGGAGTGGG - Intergenic
1077210037 11:1366442-1366464 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1078561213 11:12374638-12374660 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1079817682 11:25082888-25082910 GAATTATTGTGATGTGTAATAGG + Intergenic
1079830672 11:25263766-25263788 GAAATATAGAAATGTGAAGTGGG + Intergenic
1080287966 11:30638616-30638638 CAAATAAAGAGATGTGCAGATGG - Intergenic
1080665792 11:34334744-34334766 CAAATATTAAGATGTGCTGAAGG - Intronic
1081013853 11:37850967-37850989 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1081328035 11:41769926-41769948 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1081348137 11:42015767-42015789 TAAACACTGAGATGTGTTGTAGG - Intergenic
1082127233 11:48447606-48447628 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1082280395 11:50265539-50265561 GAAATATAGAGATGTGAAGTGGG - Intergenic
1082560797 11:54618538-54618560 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1082639944 11:55646984-55647006 CAGTTATTTAGATGAGTAGTGGG - Intergenic
1082914606 11:58418768-58418790 CAAACATAGAGGTGTGAAGTGGG - Intergenic
1083066519 11:59929666-59929688 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1085337632 11:75708196-75708218 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1086173506 11:83862460-83862482 GAAATATTGAGATGGTTAATGGG + Intronic
1086522608 11:87687577-87687599 GAAATATTTAGGTGTGGAGTGGG - Intergenic
1087371570 11:97291495-97291517 GAAATATAGAAGTGTGTAGTAGG - Intergenic
1087500426 11:98945144-98945166 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1087628547 11:100623876-100623898 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1088199255 11:107313232-107313254 CAAATTTTAAAATGTGTAATAGG + Intergenic
1088216738 11:107518856-107518878 CAAATATAGAGGTGTGAAGTGGG - Intronic
1088491887 11:110396641-110396663 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1089481839 11:118812061-118812083 AAAATGTTGATATGTGTGGTGGG + Intergenic
1090167413 11:124564864-124564886 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1092292565 12:7171158-7171180 GAAATATAGAGATGTGAAGTGGG + Intergenic
1092310023 12:7342523-7342545 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1092568687 12:9697519-9697541 GAAATATAGAGGTGTGAAGTGGG - Intronic
1092598167 12:10030395-10030417 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1092799796 12:12152991-12153013 CAGAAATGGAGATTTGTAGTAGG - Intronic
1094748659 12:33378476-33378498 TAAATATGGAGAAGTGTAGTTGG + Intronic
1095912527 12:47443406-47443428 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1096125023 12:49112829-49112851 GAAATATAGAGATGTGAAGTGGG + Intergenic
1096307617 12:50491952-50491974 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1096308311 12:50498395-50498417 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1096450223 12:51734267-51734289 GAAATATAGAGGTGTGAAGTGGG + Intronic
1097448502 12:59706744-59706766 CTAATATTAAGATATGTAGAGGG + Intronic
1097816061 12:64075078-64075100 GAAATATAGAGGTGTGAAGTAGG + Intronic
1098246642 12:68525703-68525725 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1098758810 12:74397728-74397750 CTAATAGTTAGATGGGTAGTGGG - Intergenic
1100414299 12:94355983-94356005 GAAATATAGAGGTGTGAAGTGGG - Intronic
1100472526 12:94906140-94906162 GAAATATAGAGGTGTGAAGTGGG - Intronic
1101457341 12:104848292-104848314 AAAATATTGAGATATGTGGGAGG + Intronic
1101500930 12:105302902-105302924 AAAATATAGAGGTGTGAAGTGGG + Intronic
1101767005 12:107710986-107711008 GAAATATAGAGATGTGAAGTGGG + Intronic
1101992198 12:109495549-109495571 GAAATATAGAGGTGTGGAGTAGG + Intronic
1102608815 12:114092576-114092598 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1103265946 12:119630149-119630171 CAAAGACTGAGTTGAGTAGTTGG - Intronic
1104159088 12:126161535-126161557 GAAATATTGAGCTGTGAAGCAGG + Intergenic
1105352282 13:19626745-19626767 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1105352793 13:19631140-19631162 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1105738484 13:23297335-23297357 GAAATATAGAGGTGTGAAGTGGG + Intronic
1106646849 13:31644172-31644194 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1107657201 13:42603940-42603962 AAAATAGAGAGATGTTTAGTAGG + Intronic
1107901056 13:45014256-45014278 CAAATATTTATATCTGTAGGGGG + Intronic
1108038244 13:46314458-46314480 CAAATATTGACAAGGGTAGAGGG + Intergenic
1108972296 13:56392586-56392608 GAAATATAGAGGTGTGAAGTTGG + Intergenic
1111276983 13:85963297-85963319 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1111415893 13:87943653-87943675 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1111789186 13:92831458-92831480 CAAATATTAAGATGTGTAAGAGG - Intronic
1112462732 13:99617156-99617178 CAAATATTGAAAAGTGTAAAAGG + Intronic
1114404140 14:22439238-22439260 TAAACATTGAAATGTGTGGTTGG - Intergenic
1114622529 14:24104985-24105007 GAAATATAGAGGTGTGGAGTGGG + Intronic
1115128384 14:30023738-30023760 GAAATATAGAGGTGTGAAGTGGG - Intronic
1115959502 14:38819664-38819686 GAAATATTGAGGTGTGAAGTGGG - Intergenic
1116232595 14:42236032-42236054 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1117438385 14:55739073-55739095 TACAAATTGAGATGTGTGGTAGG + Intergenic
1117588871 14:57243964-57243986 TTAATATTGAGATGTTTAATTGG - Intronic
1117600185 14:57366378-57366400 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1117631193 14:57693703-57693725 GAAATATAGAGGTGTGGAGTGGG - Intronic
1118417597 14:65559313-65559335 CAAATATTTTGATCTGTAGTTGG - Intronic
1118538262 14:66792751-66792773 GAAATATAGAGATGTGAAGTGGG + Intronic
1118587592 14:67369909-67369931 CAAATATAGGGGTGTGAAGTGGG + Intronic
1118687174 14:68302576-68302598 GAAATATAGAGGTGTGAAGTAGG + Intronic
1119138729 14:72245308-72245330 GAAATATAGAGGTGTGAAGTGGG + Intronic
1119562335 14:75601008-75601030 GAAATATAGAGGTGTGAAGTGGG + Intronic
1120261337 14:82189517-82189539 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1120323458 14:82994996-82995018 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1120702735 14:87715646-87715668 CTAATATTGAGTTGTCTTGTAGG + Intergenic
1121498503 14:94414646-94414668 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1122185600 14:99991890-99991912 TAAATATTCAGCTGTGTGGTGGG + Intronic
1122565400 14:102651182-102651204 CAAATATAGAGGTGTGAAGTGGG + Intronic
1122652724 14:103234420-103234442 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1122653318 14:103239395-103239417 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1123177849 14:106438571-106438593 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1202843872 14_GL000009v2_random:148990-149012 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1202913271 14_GL000194v1_random:139236-139258 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1202879376 14_KI270722v1_random:43449-43471 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1123673412 15:22683898-22683920 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1124325416 15:28756883-28756905 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1125214842 15:37259732-37259754 CAAATATTGACTTGTGTGGTAGG - Intergenic
1125527650 15:40388153-40388175 GAAATATAGAGGTGTGAAGTGGG + Intronic
1125779723 15:42253932-42253954 GAAATATTAAGTTGTGAAGTTGG + Intronic
1126955405 15:53928127-53928149 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1127850482 15:62907732-62907754 CATATATTGATATGGGTATTGGG - Intergenic
1128695813 15:69761739-69761761 GAAATACTGAGGTGTGTAATAGG + Intergenic
1129792263 15:78349218-78349240 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1130080151 15:80725931-80725953 GAAATATAGAGGTGTGAAGTGGG + Intronic
1130763123 15:86841520-86841542 CAAATCGTGAGATGTGTGTTGGG - Intronic
1130999263 15:88925406-88925428 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1131629001 15:94156124-94156146 CAAATAGAGAGTTTTGTAGTTGG - Intergenic
1131950554 15:97676540-97676562 CATATATTGTTATGTGTATTGGG + Intergenic
1133936305 16:10272175-10272197 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1134315495 16:13115260-13115282 GAAATATAGAGGTGTGAAGTGGG + Intronic
1135041027 16:19116323-19116345 CAAATATTGTTCTGTGTAGACGG + Exonic
1138113795 16:54344483-54344505 CCCATGTAGAGATGTGTAGTTGG - Intergenic
1138270554 16:55692806-55692828 CAACTATGGAGATGTATATTGGG - Intronic
1138913121 16:61427189-61427211 TAAATATTTAGATGTGTCTTGGG + Intergenic
1140432035 16:74912648-74912670 GAAATATAGAGGTGTGGAGTGGG + Intronic
1140652793 16:77106877-77106899 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1141278488 16:82608933-82608955 GAAGTATTGTGATGTGCAGTGGG + Intergenic
1142475453 17:186253-186275 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1143430063 17:6875214-6875236 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1145091330 17:19988384-19988406 CAAATCCTGAGATGTGAATTGGG - Intergenic
1145112877 17:20179699-20179721 CAAATATTCAGATGTCCAATTGG + Intronic
1146607514 17:34273629-34273651 CATAGATTGAGATGTAGAGTAGG + Intergenic
1146827593 17:36036756-36036778 CTTATAATAAGATGTGTAGTAGG - Intergenic
1146838449 17:36132032-36132054 CAAATATCCAGATGTATAGCTGG - Intergenic
1147719268 17:42528490-42528512 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1148216966 17:45838574-45838596 CAAATATAGAGATGTGAAGTGGG - Intergenic
1149783524 17:59416972-59416994 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1150992978 17:70282359-70282381 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1152191857 17:78892944-78892966 CAAATATTGAGAAGAGCAGGTGG + Intronic
1152830909 17:82496654-82496676 CTAGTATTGCGATGTGTGGTTGG - Intergenic
1153134761 18:1903079-1903101 GAAATATAGAGATGTGGACTGGG + Intergenic
1153351669 18:4087611-4087633 GAAATATAGAGTTGTGGAGTGGG - Intronic
1153941496 18:9982432-9982454 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1156247070 18:35311340-35311362 TAAATAGAGAAATGTGTAGTAGG - Intergenic
1156315970 18:35968948-35968970 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1156645332 18:39155415-39155437 CAGAGGTTGAGAAGTGTAGTGGG + Intergenic
1156822934 18:41394308-41394330 AAAATGTGGATATGTGTAGTAGG - Intergenic
1157023836 18:43818995-43819017 CAAAAATTAAAATGTGCAGTGGG + Intergenic
1157085495 18:44576567-44576589 CAAATCCCGAGATGTGCAGTGGG + Intergenic
1157671236 18:49530547-49530569 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1158087651 18:53672057-53672079 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1158485183 18:57859865-57859887 GAAATATTGGGATGTAGAGTAGG - Intergenic
1159194570 18:65096089-65096111 GAAATATTGAGAGGTGTATCAGG - Intergenic
1161103032 19:2430669-2430691 CAAATGGTGAGATGAGGAGTGGG + Exonic
1162282635 19:9711577-9711599 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1162283276 19:9717522-9717544 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1162652829 19:12103848-12103870 GAAATATAGAGGTGTGAAGTGGG + Intronic
1163100502 19:15093146-15093168 CAAAAAGTGAGAGGTGAAGTGGG + Intergenic
1164024445 19:21338445-21338467 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1164031611 19:21412093-21412115 GAAATATAGAGGTGTGAAGTGGG + Intronic
1164032306 19:21418600-21418622 GAAATATAGAGGTGTGAAGTGGG + Intronic
1164060254 19:21666634-21666656 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1164060937 19:21672958-21672980 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1164289230 19:23852365-23852387 CAAATATAGAGCTGTGAAGTGGG + Intergenic
1164673445 19:30086477-30086499 TAACTACTGAGATGTGTGGTTGG + Intergenic
1165301160 19:34970129-34970151 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1165402050 19:35607535-35607557 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1166252562 19:41581457-41581479 GAAATATAGAGGTGTGAAGTGGG - Intronic
1167346480 19:48948731-48948753 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1167464489 19:49642871-49642893 CAAATATTGAGATGTACTGAGGG + Intronic
1167777346 19:51567312-51567334 GAAATAATGAGATGTATGGTGGG + Intergenic
1202654995 1_KI270708v1_random:12458-12480 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1202699056 1_KI270712v1_random:149412-149434 GAAATAGAGAGTTGTGTAGTGGG - Intergenic
927117881 2:19923169-19923191 GAAATATAGAGGTGTGAAGTGGG - Intronic
927118500 2:19928421-19928443 GAAATATAGAGGTGTGAAGTGGG - Intronic
927305542 2:21567621-21567643 CAAATGTAGAGATGAGTAGAAGG - Intergenic
927641500 2:24848482-24848504 GAAATATAGAGGTGTGAAGTGGG - Intronic
927760315 2:25747130-25747152 CAAATATTGCGATAGGTGGTTGG + Intronic
928345223 2:30487398-30487420 AAAATAGTGACATTTGTAGTAGG + Intronic
928426700 2:31184374-31184396 GAAATATTCAGATGTTTAGAAGG - Intronic
929831579 2:45351044-45351066 CAGATGTTGAGATGAGGAGTGGG - Intergenic
929927999 2:46231113-46231135 GAAATATTAAGATGTGAATTGGG + Intergenic
930918120 2:56719422-56719444 GAAATATAGAGGTGTGAAGTGGG - Intergenic
930918636 2:56724128-56724150 GAAATATAGAGGTGTGAAGTGGG - Intergenic
930993560 2:57688183-57688205 GAAATATAGAGGTGTGAAGTGGG - Intergenic
931360083 2:61570706-61570728 GAAATATAGAGGTGTGAAGTGGG - Intergenic
932327520 2:70872918-70872940 GAAATATAGAGGTGTGAAGTGGG - Intergenic
933230634 2:79803296-79803318 GAAATATAGAGGTGTGAAGTGGG + Intronic
934926584 2:98386144-98386166 TAAATATTGACTTGTGTGGTAGG + Intronic
934931709 2:98431161-98431183 GAAATATAGAGGTGTGAAGTGGG + Intergenic
935138959 2:100334061-100334083 GAAATATAGAGGTGTGAAGTGGG - Intergenic
935240594 2:101174811-101174833 GAAATATAGAGGTGTGAAGTGGG + Intronic
935393015 2:102573440-102573462 CAGATACTGGGAAGTGTAGTGGG - Intergenic
935445923 2:103156887-103156909 CCAATATTTAGGTGTGTATTGGG + Intergenic
935520218 2:104095451-104095473 GAAATATAGAGGTGTGGAGTGGG + Intergenic
936799610 2:116251775-116251797 GAAATATAGAGGTGTGAAGTGGG - Intergenic
936800093 2:116256049-116256071 GAAATATAGAGGTGTGAAGTGGG - Intergenic
937171015 2:119868875-119868897 GAAATATAGAGGTGTGAAGTGGG - Intronic
937234500 2:120422441-120422463 AAAATATTGAGATGTACACTTGG + Intergenic
937610290 2:123853004-123853026 GAAATATAGAGATGTGAAGTGGG - Intergenic
940301230 2:152178079-152178101 GAAATATAGAGGTGTGAAGTGGG - Intergenic
940310470 2:152273696-152273718 CAAATATAGAGGTGTGAAGTGGG + Intergenic
940671071 2:156668614-156668636 CAAAGTTTGGGATGTGAAGTTGG - Intergenic
941239130 2:163015111-163015133 GAAATATAGAGGTGTGAAGTGGG - Intergenic
941258068 2:163258890-163258912 GAAATATAGAGGTGTGAAGTAGG + Intergenic
942837778 2:180320790-180320812 GAAATATAGAGATGTGAAGTGGG - Intergenic
943062144 2:183050336-183050358 GAAATATAGAGGTGTGGAGTGGG + Intergenic
943062528 2:183053323-183053345 GAAATATAGAGGTGTGGAGTGGG + Intergenic
943222182 2:185123815-185123837 GAAATATAGAGGTGTGAAGTGGG + Intergenic
943231364 2:185256929-185256951 CTTATGTTTAGATGTGTAGTAGG + Intergenic
943286535 2:186008360-186008382 GAAATATAGAGGTGTGAAGTGGG - Intergenic
943466094 2:188230899-188230921 GAAATATAGAGGTGTGGAGTGGG + Intergenic
943625439 2:190193685-190193707 CACATATTAAGATGTGTAATGGG - Intronic
943901735 2:193447513-193447535 GAAATATAGAGGTGTGAAGTGGG + Intergenic
943903713 2:193472481-193472503 GAAATATAGAGGTGTGAAGTGGG - Intergenic
944480448 2:200152428-200152450 CAAATATAGAGGTGTGAAGTGGG - Intergenic
945621012 2:212137097-212137119 AAAACATTTAGATGAGTAGTGGG + Intronic
946206496 2:218112678-218112700 GAAATATAGAGGTGTGGAGTGGG - Intergenic
946206985 2:218116916-218116938 GAAATATAGAGCTGTGGAGTGGG - Intergenic
946210712 2:218144987-218145009 GAAATATAGAGGTGTGAAGTGGG - Intergenic
946380713 2:219346871-219346893 GAAATATAGAGGTGTGAAGTGGG + Intergenic
946435795 2:219652099-219652121 GAAATATAGAGGTGTGAAGTGGG - Intergenic
946974982 2:225138706-225138728 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1169096031 20:2899517-2899539 CAAATGTTGAGATTTGTGGTTGG + Intronic
1169404060 20:5308622-5308644 GAAATATAGAGGTGTGAAGTGGG - Intronic
1169960530 20:11154474-11154496 CAAATATTGACATATGCAATGGG + Intergenic
1172715815 20:36962719-36962741 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1173461636 20:43247796-43247818 CACATATTGACATGTGTATATGG - Intergenic
1175732946 20:61366440-61366462 GAAATATAGAGGTGTGAAGTGGG + Intronic
1176632623 21:9153906-9153928 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1176640680 21:9300913-9300935 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1177377523 21:20292770-20292792 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1177519144 21:22194877-22194899 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1177683808 21:24410642-24410664 CAAATATAGAGGGGTGAAGTGGG + Intergenic
1178227860 21:30744655-30744677 CAAATGGTGAGCTGTTTAGTAGG + Intergenic
1178321520 21:31609705-31609727 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1178423814 21:32462965-32462987 GAAATATAGAGGTGTGGAGTGGG - Intronic
1178617373 21:34145689-34145711 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1179957051 21:44747051-44747073 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1180349705 22:11790296-11790318 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1180373996 22:12073746-12073768 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1180388498 22:12201943-12201965 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1181172851 22:21019666-21019688 TAAATATAGAGGTGTGGAGTGGG + Intronic
1181593781 22:23900625-23900647 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1181784306 22:25215514-25215536 GAAATATGGAGATGTGGAATGGG - Intergenic
1181835229 22:25600469-25600491 CAAATATTTTGAGGCGTAGTTGG - Intronic
1182226848 22:28805354-28805376 GAAATATAGAGGTGTGAAGTGGG + Intergenic
949468878 3:4372774-4372796 AAATTATTGAGATGTGGATTAGG - Intronic
949651635 3:6166828-6166850 GAAATATAGAGCTGTGAAGTGGG + Intergenic
951256657 3:20457829-20457851 GAAATATAGAGGTGTGGAGTGGG + Intergenic
951270098 3:20614451-20614473 GAAATATAGAGGTGTGAAGTCGG + Intergenic
951821880 3:26823089-26823111 GAAATATAGAGGTGTGAAGTGGG + Intergenic
951839472 3:27018531-27018553 CACATTTTGAAATGTGGAGTTGG + Intergenic
951920310 3:27847382-27847404 CAAATATTTTGATCTGCAGTTGG - Intergenic
953731064 3:45448510-45448532 GAAATATAGAGGTGTGAAGTGGG + Intronic
954507008 3:51086010-51086032 GAAATATAGAGGTGTGGAGTGGG + Intronic
955632316 3:60987616-60987638 GAAATATAGAGGTGTGAAGTGGG - Intronic
956558455 3:70547067-70547089 AAAATATTTAGATGTTCAGTTGG - Intergenic
956709938 3:72030238-72030260 GAAATATAGAGGTGTGAAGTGGG + Intergenic
956943999 3:74198012-74198034 GAAATATAGAGATGTGAAGTGGG - Intergenic
956981741 3:74647144-74647166 GAAATATAGAGGTGTGAAGTGGG + Intergenic
957099476 3:75809698-75809720 GAAATATAGAGGTGTGAAGTGGG + Intergenic
957975735 3:87442287-87442309 AAAATATTTAGATGTCTAATTGG + Intergenic
958738853 3:98043503-98043525 GAAATATAGAGGTGTGAAGTGGG + Intergenic
959653308 3:108772592-108772614 CAAATATAGAAGTGTGCAGTGGG - Intergenic
960793812 3:121462555-121462577 CAAATATTAAGTTGTGCAGGGGG + Intronic
961265354 3:125637312-125637334 GAAATATAGAGGTGTGAAGTAGG + Intergenic
961323177 3:126092514-126092536 CAAATATAGAGGTGTGAAGTGGG - Intronic
961689999 3:128662477-128662499 GAAATATAGAGGTGTGAAGTGGG + Intronic
963415069 3:144984468-144984490 GAAATATAGAGGTGTGAAGTGGG + Intergenic
963962518 3:151324828-151324850 CAAATGTTGAGATGTGTTTCTGG + Intronic
965557268 3:170031441-170031463 GAAATATAGAGGTGTGGAGTGGG + Intergenic
965561251 3:170064157-170064179 CAAAATTAGAGATTTGTAGTGGG + Intronic
966009444 3:175056576-175056598 GAAATATAGAGGTGTGGAGTGGG + Intronic
966182771 3:177201868-177201890 GACATCTTGAGATGTGTGGTTGG - Intergenic
966495787 3:180578775-180578797 GAAATATAGAGGTGTGAAGTGGG - Intergenic
966612968 3:181886662-181886684 CCACTATTGAGATGTGTGATGGG + Intergenic
966978247 3:185105625-185105647 GAAATATAGAGGTGTGAAGTGGG - Intronic
966978842 3:185110959-185110981 GAAATATAGAGGTGTGAAGTGGG - Intronic
967593902 3:191308528-191308550 CAATTATTGAGATTTGGGGTTGG + Intronic
968855079 4:3113961-3113983 GAAATATAGAGGTGTGAAGTGGG + Intronic
970391951 4:15621053-15621075 GAAATATAGAGGTGTGAAGTGGG - Intronic
971731381 4:30386644-30386666 CACATGTTTAGGTGTGTAGTGGG + Intergenic
971871517 4:32245999-32246021 GAAATATAGAGGTGTGGAGTGGG - Intergenic
971873395 4:32273543-32273565 GAAATATAGAGGTGTGAAGTGGG + Intergenic
972080158 4:35140165-35140187 GAAATATAGAGGTGTGAAGTGGG - Intergenic
972096673 4:35355532-35355554 CAAATAATAACATGTGTAGTAGG - Intergenic
972444458 4:39130109-39130131 GAAATATAGAGGTGTGAAGTGGG + Intergenic
972655500 4:41059812-41059834 GAAATATAGAGGTGTGAAGTGGG - Intronic
973274576 4:48293381-48293403 GAAATATAGAGGTGTGAAGTGGG + Intergenic
973595364 4:52483097-52483119 AAAATATTGAGAAGTGGAGTAGG - Intergenic
974535046 4:63163880-63163902 GAAATATAGAGGTGTGGAGTGGG + Intergenic
974564005 4:63560235-63560257 CAAGTATTGAGATGGATAGAAGG - Intergenic
974767098 4:66360848-66360870 GAAATATAGAGGTGTGAAGTGGG - Intergenic
975029344 4:69595375-69595397 CAAACGTTGAGATACGTAGTAGG + Intronic
975541543 4:75517433-75517455 CAACTTTTGTAATGTGTAGTAGG + Intronic
975575451 4:75858018-75858040 GAAATATAGAGGTGTGAAGTGGG + Intergenic
975697902 4:77032023-77032045 CAATAATTGAGATGTGTTATAGG + Intronic
976100425 4:81556608-81556630 CAAATATTAAAATGTGAAGAGGG - Intronic
976128460 4:81858243-81858265 GAAATATAGAGGTGTGAAGTGGG + Intronic
976179554 4:82386305-82386327 GAAATATAGAGGTGTGAAGTGGG + Intergenic
976263981 4:83173078-83173100 GAAATATAGAGGTGTGAAGTGGG + Intergenic
976549647 4:86379834-86379856 AAAATATAGAGGTGTGGAGTGGG - Intronic
977070592 4:92380481-92380503 CAAATATGTAGAGGTGGAGTTGG - Intronic
977358703 4:95978594-95978616 GAAATATAGAGGTGTGAAGTGGG - Intergenic
977419940 4:96786659-96786681 CATATTTTTAGATGTGTTGTAGG - Intergenic
977625655 4:99187194-99187216 GAAATATAGAGGTGTGGAGTGGG + Intergenic
977626096 4:99191098-99191120 GAAATATAGAGGTGTGGAGTGGG + Intergenic
977638429 4:99327822-99327844 GAAATATAGAGGTGTGGAGTGGG + Intergenic
977641937 4:99367475-99367497 GAAATATAGAGGTGTGGAGTGGG - Intergenic
977652494 4:99486456-99486478 GAAATATAGAGGTGTGGAGTGGG + Intergenic
977653086 4:99491849-99491871 GAAATATAGAGGTGTGGAGTGGG + Intergenic
978011598 4:103691994-103692016 GAAATATAGAGGTGTGAAGTGGG - Intronic
978032379 4:103950979-103951001 GAAATATAGAGGTGTGAAGTGGG + Intergenic
979893534 4:126131158-126131180 GAAATATAGAGGTGTGGAGTGGG - Intergenic
979893998 4:126135043-126135065 GAAATATAGAGGTGTGGAGTGGG - Intergenic
980245015 4:130227393-130227415 GAAATATAGAGGTGTGAAGTGGG - Intergenic
981908216 4:149948034-149948056 CAAATATTCATATGTATTGTAGG - Intergenic
981917870 4:150054252-150054274 GAAATATAGAGGTGTGAAGTGGG - Intergenic
982074847 4:151728478-151728500 CAAATATTCAGAGTTGAAGTAGG - Intronic
982345240 4:154350658-154350680 CAAATATAGAGATGTATAAATGG - Intronic
982519355 4:156393557-156393579 GAAATATAGAGGTGTGAAGTGGG - Intergenic
983972563 4:173892830-173892852 GAAATATAGAGGTGTGGAGTGGG + Intergenic
983994700 4:174167756-174167778 AAAATATTGAAATGTGTATATGG + Intergenic
984363456 4:178767913-178767935 GAAATATAGAGGTGTGAAGTGGG - Intergenic
984383297 4:179023265-179023287 CAAATATAGGGTTGTGTATTAGG - Intergenic
984903412 4:184604891-184604913 GAAATATAGAGGTGTGAAGTGGG - Intergenic
984955848 4:185044858-185044880 GAAATATAGAGGTGTGAAGTGGG + Intergenic
984956560 4:185051267-185051289 TAAATATAGAGGTGTGAAGTGGG + Intergenic
984964051 4:185125999-185126021 GAAATATAGAGGTGTGAAGTGGG - Intergenic
985260320 4:188108814-188108836 AAAATAAGGAGATGAGTAGTGGG - Intronic
1202755579 4_GL000008v2_random:59185-59207 GAAATATAGAGGTGTGAAGTGGG - Intergenic
985614159 5:909606-909628 CAAATATAGAGGTGTGAAGTGGG + Intronic
986467200 5:8037568-8037590 GAAATATAGAGGTGTGAAGTGGG + Intergenic
986954605 5:13135902-13135924 GAAATATAGAGGTGTGAAGTGGG + Intergenic
987482821 5:18480182-18480204 GAAATATAGAGGTGTGAAGTGGG + Intergenic
987581341 5:19796814-19796836 AAAATGTTGATATGTGTAGATGG + Intronic
988343855 5:30012222-30012244 GAAATATAGAGGTGTGAAGTGGG + Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
989046584 5:37279882-37279904 GAAATATAGAGGTGTGAAGTGGG + Intergenic
989065174 5:37453231-37453253 GAAATATAGAGCTGTGAAGTGGG + Intronic
989345575 5:40425683-40425705 GAAATATAGAGGTGTGAAGTGGG - Intergenic
989426126 5:41297983-41298005 GAAATATAGAGGTGTGGAGTGGG + Intergenic
989742431 5:44788999-44789021 CAAATATAGAGGTGTGAACTGGG - Intergenic
989758610 5:44986341-44986363 GAAATATAGAGGTGTGAAGTGGG - Intergenic
990306452 5:54498287-54498309 GAAATATAGAGGTGTGAAGTGGG + Intergenic
990307183 5:54504985-54505007 GAAATATAGAGGTGTGAAGTGGG + Intergenic
991570429 5:68048044-68048066 GAAATATGGAGGTGTGAAGTGGG + Intergenic
992254511 5:74908220-74908242 GAAATATAGAGGTGTGAAGTGGG + Intergenic
992447302 5:76845622-76845644 GAAATATAGAGGTGTGAAGTGGG - Intergenic
992567922 5:78020081-78020103 CAAGTATTAATATCTGTAGTTGG - Intronic
993222110 5:85111871-85111893 GAAATATAGAGGTGTGAAGTGGG - Intergenic
993405792 5:87510753-87510775 GAAATATAGAGATGTGAAGTGGG - Intergenic
993406649 5:87519369-87519391 GAAATATAGAGGTGTGAAGTGGG - Intergenic
993406759 5:87520289-87520311 GAAATATAGAGGTGTGAAGTGGG - Intergenic
993570458 5:89531753-89531775 TAAATATTGGGTTTTGTAGTTGG + Intergenic
993637028 5:90357108-90357130 CAAATATTTTGATGTGTTTTAGG + Intergenic
994085238 5:95751035-95751057 TAAATATTTAGGTGTGTGGTGGG + Intronic
994305936 5:98204140-98204162 GAAATATAGAGGTGTGAAGTGGG - Intergenic
995108448 5:108401186-108401208 GAAATATGGAGATGTGAAGTGGG + Intergenic
995605963 5:113855233-113855255 GAAATATAGAGGTGTGAAGTGGG - Intergenic
995665725 5:114539845-114539867 GAAATATAGAGGTGTGAAGTGGG - Intergenic
995959438 5:117821842-117821864 GAAATATAGAGGTGTGAAGTGGG - Intergenic
996291842 5:121860520-121860542 GAAATATAGAGGTGTGAAGTGGG + Intergenic
996462142 5:123758101-123758123 CAAACATTGGGAAGGGTAGTAGG - Intergenic
996656284 5:125940746-125940768 GAAATATAGAGGTGTGAAGTGGG - Intergenic
997393449 5:133535638-133535660 GAAATATAGAGGTGTGAAGTGGG - Intronic
997634420 5:135394432-135394454 CAAATAGAGAGATGTGTTGGAGG - Intronic
998924121 5:147103793-147103815 CAAATATTGATATGTGAAGATGG + Intergenic
999552576 5:152705191-152705213 GAAATATAGAGGTGTGAAGTGGG - Intergenic
999851900 5:155549625-155549647 CAACTATTGAGATGTTTATATGG + Intergenic
1000588158 5:163125383-163125405 GAAATATAGAGGTGTGAAGTTGG - Intergenic
1003196183 6:3917137-3917159 GAAATATTGAGGTGTGGAGTGGG - Intergenic
1003510613 6:6776865-6776887 AAAATATTGAGAGGTTTAATAGG - Intergenic
1003761635 6:9185110-9185132 AAAATATAGAGGTGTGGAGTGGG - Intergenic
1004246899 6:13986858-13986880 CATATATTTAGATATTTAGTAGG - Intergenic
1004888020 6:20070589-20070611 GAAGTCTTAAGATGTGTAGTTGG - Intergenic
1005013405 6:21356882-21356904 CAAAAGGTGAGATGTTTAGTGGG + Intergenic
1005185542 6:23159977-23159999 GAAATATAGAGATGTGAAGTGGG - Intergenic
1005857741 6:29875718-29875740 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1005858346 6:29881386-29881408 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1005865891 6:29936244-29936266 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1006038749 6:31235651-31235673 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1006050454 6:31338824-31338846 GAAATATAGAGGTGTGAAGTGGG + Intronic
1006497031 6:34431201-34431223 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1006860153 6:37166644-37166666 TAAACATTCAGATGTGTTGTGGG - Intergenic
1007035313 6:38667776-38667798 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1007333545 6:41134472-41134494 TTCATTTTGAGATGTGTAGTTGG - Intergenic
1008093164 6:47312752-47312774 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1008093603 6:47316332-47316354 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1008190653 6:48453023-48453045 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1008305808 6:49898638-49898660 CAAATATGGTGATGTGTATACGG + Intergenic
1009737904 6:67702911-67702933 CAAATATAGAGGTGTGAAGTGGG + Intergenic
1009955585 6:70448610-70448632 GAAATATAGAGGTGTGGAGTGGG + Intronic
1010402918 6:75467649-75467671 AAAATTTTGAGATTTCTAGTGGG - Intronic
1010433694 6:75806892-75806914 GAAATATAGAGGTGTGAAGTGGG - Intronic
1010510861 6:76717517-76717539 AAAATATTGAGGAGAGTAGTAGG - Intergenic
1010796053 6:80117868-80117890 GAAATATAGAGTTGTGGAGTGGG - Intronic
1010880650 6:81165765-81165787 CAAATTTTCAGATGTGATGTTGG - Intergenic
1011796853 6:90964983-90965005 CAGAGATTGAGAAGGGTAGTAGG - Intergenic
1011969019 6:93198258-93198280 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1012601977 6:101109888-101109910 CAAAAATTGAGATGTACATTGGG - Intergenic
1012930148 6:105308123-105308145 CAAATACTGAGAAGTGAAGAAGG + Intronic
1013475082 6:110499595-110499617 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1014719598 6:124900217-124900239 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1014926253 6:127274547-127274569 TAATAATTGAGATGTGTAGAAGG - Intronic
1015347661 6:132178879-132178901 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1015704643 6:136074575-136074597 CAAATGCTGGGAAGTGTAGTGGG - Intronic
1015825339 6:137305179-137305201 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1015839081 6:137456892-137456914 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1015875800 6:137821299-137821321 AAAATATTGAAATGAATAGTAGG - Intergenic
1017715617 6:157210266-157210288 CAAATATGGAGATTTGTAAGAGG + Exonic
1018173092 6:161157060-161157082 GAAATATAGAGATGTGAAGTGGG - Intronic
1018594535 6:165464088-165464110 GAAATATGGAGGTGTGAAGTGGG - Intronic
1019233682 6:170590197-170590219 CAAATATAGAGGTGTGAAGTGGG + Intergenic
1020571039 7:9861789-9861811 CAGATATTGGGAAGGGTAGTGGG + Intergenic
1023242864 7:38167628-38167650 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1023403753 7:39810614-39810636 GAAATATGGAGGTGTGAAGTGGG + Intergenic
1024102321 7:46044730-46044752 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1024312838 7:47985275-47985297 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1024712557 7:52033572-52033594 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1024911183 7:54449261-54449283 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1024911792 7:54455090-54455112 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1024912007 7:54457045-54457067 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1025102242 7:56145257-56145279 GAAATATTGAGGTGTGAAGTGGG - Intergenic
1025103655 7:56153361-56153383 GAAATATCGAGGTGTATAGTGGG - Intergenic
1025816276 7:64915328-64915350 GAAATATAGAGGTGTGAAGTGGG + Intronic
1025873542 7:65458234-65458256 CAAATTTCATGATGTGTAGTAGG + Intergenic
1026268066 7:68812731-68812753 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1028155770 7:87427614-87427636 AAACTATTAAGATGTGTAGTTGG - Intronic
1028309951 7:89318827-89318849 GAAATATAGAGGTGTGAAGTGGG + Intronic
1028855884 7:95593421-95593443 CCAATAATGAGATGTGTAGGAGG - Intronic
1029341765 7:99950774-99950796 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1030365898 7:108645713-108645735 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1030783216 7:113627235-113627257 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1031133380 7:117859428-117859450 CAAACATTGATGTGAGTAGTGGG + Intronic
1031795790 7:126173104-126173126 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1032767529 7:135012490-135012512 CAAATATTTAAATGTTTATTAGG - Intronic
1033639126 7:143243796-143243818 CAAATCTTGAGAGCAGTAGTAGG + Intergenic
1033878726 7:145855445-145855467 CAAATATAGAGGTGTGAAGTGGG - Intergenic
1034012307 7:147543033-147543055 GAAATATAGAGGTGTGAAGTGGG + Intronic
1034538163 7:151738812-151738834 GAAATATAGAGGTGTGAAGTGGG - Intronic
1036145382 8:6250286-6250308 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1037560171 8:20066297-20066319 CAAAAGTTGACAAGTGTAGTTGG - Intergenic
1039036706 8:33367529-33367551 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1039338534 8:36621647-36621669 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1039691622 8:39870805-39870827 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1039692204 8:39875918-39875940 GAAATATAGAGATGTGGAGTGGG - Intergenic
1040381428 8:46876959-46876981 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1040381890 8:46881190-46881212 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1040528396 8:48244583-48244605 GAAATATAGAGATGTGAAGTGGG + Intergenic
1040528993 8:48250074-48250096 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1040529675 8:48256459-48256481 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1040530024 8:48259246-48259268 CAGATATTAAGATTTGTAATGGG + Intergenic
1040608851 8:48962710-48962732 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1040645417 8:49391280-49391302 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1040688473 8:49906164-49906186 TAAATATTGAGATAACTAGTTGG + Intergenic
1040782408 8:51125515-51125537 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1040854479 8:51934127-51934149 GAAATATAGAGATGTGAAGTGGG - Intergenic
1041065299 8:54076923-54076945 GAAATATAGAGGTGTGAAGTGGG - Intronic
1041530627 8:58861824-58861846 CAAAAATAGAGATGTCAAGTGGG + Intronic
1042096677 8:65223408-65223430 AAAATACTGAGATTTGTTGTAGG + Intergenic
1043084858 8:75816696-75816718 AAAATATTGAGAAGTATGGTGGG - Intergenic
1043318693 8:78953768-78953790 CAGAGGTTGAGAAGTGTAGTGGG + Intergenic
1043776423 8:84276276-84276298 CAAATACTGAAATGTGTTATTGG + Intronic
1043910567 8:85858849-85858871 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1044016256 8:87051445-87051467 GAAATATAGAGGTGTGGAGTGGG + Intronic
1044030781 8:87233880-87233902 CAAATTTTGAAATGTTTTGTGGG - Intronic
1045737324 8:105311656-105311678 GAATTATTGAGATGTGAGGTAGG + Intronic
1045861108 8:106815842-106815864 CAAATATAGAGATATGTAAGAGG - Intergenic
1046231255 8:111361601-111361623 TAAATATAGAGAAATGTAGTTGG + Intergenic
1046479842 8:114801263-114801285 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1046733990 8:117756223-117756245 GAGACATTGAGATGAGTAGTTGG - Intergenic
1047144006 8:122176297-122176319 CAAATTTTGATATTTGTATTTGG + Intergenic
1048060725 8:130916893-130916915 GAAATATAGAGGTGTGAAGTGGG - Intronic
1048437145 8:134428899-134428921 CAGTCATTGAGAGGTGTAGTGGG + Intergenic
1048701960 8:137101742-137101764 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1048772395 8:137908880-137908902 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1048958885 8:139559192-139559214 CAAATATGCAGATGTGTACATGG - Intergenic
1049460613 8:142726120-142726142 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1049860854 8:144897632-144897654 GAAATATAGAGGTGTGAAGTGGG + Intronic
1050129257 9:2393157-2393179 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1051271483 9:15359658-15359680 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1051675595 9:19555112-19555134 AACATATTGTGATGTGAAGTGGG - Intronic
1053205245 9:36180625-36180647 CAAATATAGAGGTGTGAAGTGGG - Intergenic
1055318353 9:75056480-75056502 GAAATATAGAGGTGTGCAGTGGG - Intergenic
1055408333 9:75999347-75999369 GAAATATAGAGGTGTGAAGTGGG + Intronic
1055452467 9:76443262-76443284 GAAATATAGAGGTGTGAAGTGGG + Intronic
1056620262 9:88206570-88206592 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1057285583 9:93751132-93751154 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1057380905 9:94566598-94566620 GAAATATAGAGGTGTGAAGTGGG - Intronic
1057625184 9:96670310-96670332 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1057627794 9:96693112-96693134 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1057646751 9:96883722-96883744 CAAAGATTTCTATGTGTAGTAGG - Intergenic
1059136628 9:111813433-111813455 CAAACATTGAGAAGTGTGGGAGG + Intergenic
1059867763 9:118535730-118535752 CAAATATTGAGATAGGGAGATGG - Intergenic
1061602524 9:131680794-131680816 GAAATATAGAGGTGTGAAGTGGG - Intronic
1061603102 9:131685721-131685743 GAAATATAGAGGTGTGAAGTGGG - Intronic
1061698149 9:132393658-132393680 GAAATATAGAGGTGTGAAGTGGG - Intronic
1203687178 Un_GL000214v1:6228-6250 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1203755456 Un_GL000218v1:121530-121552 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1203714832 Un_KI270742v1:134070-134092 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1203536382 Un_KI270743v1:44021-44043 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1203649097 Un_KI270751v1:97825-97847 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1186095736 X:6099930-6099952 GAAATATAGAGGTGTGGAGTGGG + Intronic
1186277641 X:7957294-7957316 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1186353595 X:8766569-8766591 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1187381113 X:18803024-18803046 GAAATATAGAGGTGTGAAGTGGG + Intronic
1187839474 X:23471967-23471989 GAAATATGGTGATGTCTAGTAGG - Intergenic
1188116005 X:26243655-26243677 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1188614324 X:32138712-32138734 CAAATATTGAGAGGCAGAGTTGG + Intronic
1188865651 X:35310388-35310410 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1188894086 X:35645246-35645268 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1188965469 X:36545944-36545966 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1189670348 X:43401471-43401493 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1189977971 X:46481587-46481609 GAAATATAGAGGTGTGAAGTGGG + Intronic
1190184163 X:48220357-48220379 GAAATATAGAGGTGTGAAGTGGG - Intronic
1190523480 X:51304381-51304403 CAGAGACTGAGATGGGTAGTTGG + Intergenic
1190974282 X:55384785-55384807 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1191703288 X:64065822-64065844 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1191833323 X:65438519-65438541 GAAATATAGAGGTGTGAAGTGGG + Intronic
1191833880 X:65443427-65443449 GAAATATAGAGGTGTGAAGTGGG + Intronic
1191949089 X:66569202-66569224 CAAATATAGAGGTGTGCAGTGGG + Intergenic
1192687081 X:73318388-73318410 GAAATATGGAGGTGTGAAGTGGG + Intergenic
1192687760 X:73324693-73324715 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1193048559 X:77078045-77078067 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1193049016 X:77081837-77081859 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1193063242 X:77229303-77229325 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1193579645 X:83248741-83248763 CAAATATTAAGTGGTGGAGTTGG + Intergenic
1194011191 X:88564365-88564387 CATCTATTGAGATATGTATTTGG - Intergenic
1194913220 X:99673092-99673114 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1196931648 X:120687512-120687534 CAAATATACAGATGAGTAGAGGG + Intergenic
1196996943 X:121394544-121394566 CAGATATTTCGATCTGTAGTTGG - Intergenic
1197538769 X:127727578-127727600 TTAATATTGAGATGTGTAGGAGG + Intergenic
1200095653 X:153659181-153659203 CATATTTTGATATGTGTAATTGG + Intergenic
1200326752 X:155248596-155248618 CACATATGGAGATGTCAAGTAGG - Intergenic
1200906165 Y:8484985-8485007 TAAATATAGAGGTGTGGAGTGGG + Intergenic
1200978404 Y:9238477-9238499 GAAATATTGAGGTGTGAACTGGG - Intergenic
1201169072 Y:11239136-11239158 GAAATATAGAGGTGTGAAGTGGG + Intergenic
1201369969 Y:13252948-13252970 GAAATATAGAGGTGTGAAGTGGG - Intronic
1201370637 Y:13259275-13259297 GAAATACAGAGATGTGAAGTGGG - Intronic
1201402184 Y:13615058-13615080 CAAATCTTCAGATGTTTGGTGGG + Intergenic
1201512996 Y:14786182-14786204 GGAATATTGACATGTGTAGATGG - Intronic
1201700788 Y:16879245-16879267 GAAATATAGAGGTGTGAAGTGGG - Intergenic
1201892964 Y:18962798-18962820 GAAATATAGAGGTGTGGAGTGGG + Intergenic
1201926483 Y:19293473-19293495 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1201926976 Y:19298187-19298209 GAAATATAGAGGTGTGGAGTGGG - Intergenic
1202019391 Y:20449267-20449289 GAAATATAGAGGTGTGAAGTGGG + Intergenic