ID: 1067959549

View in Genome Browser
Species Human (GRCh38)
Location 10:50832997-50833019
Sequence ATCTATCAGCTAATGATACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067959549_1067959551 22 Left 1067959549 10:50832997-50833019 CCCAGTATCATTAGCTGATAGAT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1067959551 10:50833042-50833064 GACTGAAGAATAGAATCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067959549 Original CRISPR ATCTATCAGCTAATGATACT GGG (reversed) Intronic
905248592 1:36631593-36631615 TTCTTTCCGATAATGATACTAGG + Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910346668 1:86246798-86246820 ATATACCAGCTGATGAAACTGGG + Intergenic
911028026 1:93455665-93455687 ATAAATCAGCTCATGAAACTAGG - Intronic
912057232 1:105618545-105618567 ATATTTCAGATAATGATTCTTGG + Intergenic
913400972 1:118432496-118432518 CTCTCTGACCTAATGATACTGGG + Intergenic
914201004 1:145485620-145485642 ATCTATCAAATAATAATACAGGG + Intergenic
915054604 1:153114695-153114717 ATCTAGCAGGTCATGAGACTAGG - Intergenic
917434365 1:175004231-175004253 GTCTAACATCTAATGACACTCGG + Intronic
921017950 1:211209409-211209431 ATCTTTCAGCTAAAAATACCTGG - Intergenic
1063646727 10:7892002-7892024 ATCTATCTGTTAATGAAAATTGG - Intronic
1065574900 10:27107731-27107753 ATCCAATAGCTAAGGATACTCGG - Intergenic
1067654990 10:48184974-48184996 AACTATCAGCTAATGCCACTTGG - Intronic
1067959549 10:50832997-50833019 ATCTATCAGCTAATGATACTGGG - Intronic
1068530218 10:58177289-58177311 ATTTATCTGCTAAACATACTGGG + Intergenic
1068847365 10:61693170-61693192 ATCTTTAAGAGAATGATACTGGG + Intronic
1078944516 11:16049065-16049087 ACCTATGAGCTAGTAATACTAGG + Intronic
1079022598 11:16922213-16922235 ACCTCTCAGCTAATGATCCAAGG + Intronic
1080944588 11:36957270-36957292 ATCTATCTTCTAAAGATAATTGG - Intergenic
1086206300 11:84262105-84262127 ATCTATAAGATAATCATAATTGG - Intronic
1086245199 11:84743494-84743516 AACTATAAGCTAAGGATACAAGG + Intronic
1088742213 11:112776433-112776455 GTCTATCAGATAATGACGCTGGG + Intergenic
1089928321 11:122282330-122282352 ATTTATAATCTTATGATACTGGG - Intergenic
1093471215 12:19504170-19504192 ATTTTTCAGATAATGAAACTAGG + Intronic
1097732268 12:63141784-63141806 ATCTATAGGCAAATGATAGTAGG - Intergenic
1099535517 12:83838949-83838971 AACATTCAGTTAATGATACTTGG - Intergenic
1100041113 12:90318324-90318346 ATCAAATAGCTAATGATATTTGG - Intergenic
1101475920 12:105048390-105048412 CTCTATCTGCTAAGGAGACTGGG - Intronic
1102189205 12:110973387-110973409 ATTTATCAGCTCATGTGACTGGG - Intergenic
1102317256 12:111899233-111899255 ATAAATCAGTTAATGATTCTGGG - Intergenic
1104551506 12:129761417-129761439 AGCTATGAACTAGTGATACTCGG + Intronic
1109096640 13:58127203-58127225 ATCTATTATCTAAAGAAACTGGG - Intergenic
1109290430 13:60467803-60467825 AAATATTAGCTAATGAGACTAGG - Intronic
1109769679 13:66954561-66954583 GTCTATCAGCAAAGGATACTTGG + Intronic
1110024393 13:70516218-70516240 AACTATCACATAATGATAATGGG + Intergenic
1110643726 13:77856207-77856229 ACCTAACAGCTAATCATTCTTGG + Intergenic
1111083927 13:83348864-83348886 ATCTATCTGCTAATGATTTTAGG - Intergenic
1112657732 13:101470061-101470083 ATCTCACAGCTAATGAGGCTAGG - Intronic
1113743929 13:112729703-112729725 CTCTATCAGCTAAAGATAGCAGG - Intronic
1117266838 14:54097816-54097838 GTCTTTCAGCAAATGATGCTGGG + Intergenic
1118525851 14:66641620-66641642 TTCTATCAGCTATTGATGGTTGG - Intronic
1120070674 14:80098978-80099000 ATCTTTGAGCTCATGATTCTTGG + Intergenic
1122368056 14:101208309-101208331 ATCTATCTGCTACTGAAATTAGG + Intergenic
1124127385 15:26948484-26948506 AACTATCAACGTATGATACTGGG - Exonic
1125831379 15:42719171-42719193 ATCTATCTCCTAAGGACACTGGG - Intronic
1126195772 15:45928974-45928996 TCCTAACAACTAATGATACTTGG + Intergenic
1132068764 15:98756145-98756167 TTCTATCAGGTATTGATATTAGG + Intronic
1132140592 15:99390166-99390188 ATCTATTAGCTGATGACACAAGG - Exonic
1148073939 17:44924799-44924821 ATATAAATGCTAATGATACTTGG - Intronic
1154142743 18:11839657-11839679 ATTTGTCAGCTGATGACACTTGG - Intronic
1165536685 19:36453547-36453569 ATCTATTAGCAAATGATTGTAGG - Intronic
925241730 2:2337265-2337287 ATTTGTCAGCTCATGATACATGG + Intergenic
925432688 2:3809329-3809351 ATCTACATGCTAATGATATTGGG + Intronic
927399128 2:22690376-22690398 AAATATCAGCTAATTAAACTTGG - Intergenic
935002795 2:99037065-99037087 ATCTGTCAGTTACTGATACATGG - Intronic
936739079 2:115482771-115482793 ATTAATCAGTTCATGATACTGGG + Intronic
937748934 2:125450461-125450483 ATCTCTGAGGTTATGATACTTGG + Intergenic
940454252 2:153875022-153875044 ATATATCAGCTTAAAATACTTGG + Intronic
940533652 2:154909973-154909995 ACTTATCAGCAAATGGTACTGGG - Intergenic
946808746 2:223499304-223499326 ATCTACCAGCCACAGATACTAGG + Intergenic
1174623977 20:51899209-51899231 ATCTATCAGTTTATTAGACTTGG - Intergenic
1177205614 21:18006905-18006927 GGCCATCAGCTAATGATTCTTGG + Intronic
952036592 3:29210109-29210131 ATCTATCATTTTATGACACTGGG - Intergenic
952302251 3:32113724-32113746 ATTTATTAGCTCATGATTCTGGG + Intronic
959614251 3:108329581-108329603 ATGTATTGGCTCATGATACTGGG + Intronic
963177919 3:142321072-142321094 ATCTTTCAGCAAATGGTGCTGGG - Intronic
967923085 3:194627209-194627231 TTCTATTAGCTAATGAGAATGGG + Intronic
968205785 3:196798834-196798856 TTCTATCAGCAATGGATACTGGG - Intronic
970467394 4:16339034-16339056 ATCTTTCAATAAATGATACTGGG - Intergenic
971067667 4:23052239-23052261 ATGTGTCAGGTAATGGTACTGGG - Intergenic
977789192 4:101078627-101078649 AACTATCAGCTTATAATTCTAGG + Intronic
978028839 4:103912956-103912978 ATCTATCAGCTATTGAAAAGAGG + Intergenic
986662477 5:10071685-10071707 ATCTTTCAGATAAGGAAACTGGG - Intergenic
986797762 5:11228798-11228820 ATCTATATGCTATTGATATTTGG + Intronic
988733256 5:33994670-33994692 ATCTGTCAGCTAAGGATCCTAGG + Intronic
988910575 5:35837119-35837141 ATCTATCTGCTCATGATACGAGG - Intergenic
989005703 5:36809767-36809789 ATCTATCAGCTCATGTAAGTTGG + Intergenic
990250065 5:53904541-53904563 AACTATAAGTTAAAGATACTTGG - Intronic
994008185 5:94866220-94866242 TTCTGTCAGCTATTTATACTGGG + Intronic
997934687 5:138100036-138100058 ATCAGTGAGCTAATGAAACTTGG + Intergenic
1000060718 5:157652628-157652650 ACCTATTAGCTAATGTTGCTGGG + Intronic
1000231777 5:159322295-159322317 ACCTATCAGTTAATGATAATGGG - Intronic
1000595076 5:163206307-163206329 ATAAATCAGCTAATGACAGTGGG - Intergenic
1002037490 5:176483496-176483518 ATCTTTCAACAAATGATGCTGGG - Intronic
1003299789 6:4868699-4868721 GTCTATCAGTTATTGATAGTGGG + Intronic
1003543021 6:7034708-7034730 ATCTTTCAGTTTATGACACTGGG - Intergenic
1004139712 6:13006010-13006032 CACCATCAGCTAATGATAATTGG - Intronic
1008286673 6:49661208-49661230 ATCTTTCAACAAATGATATTGGG + Intergenic
1009821492 6:68807659-68807681 ATCTGTAAGCTACTGATAATTGG - Intronic
1010304026 6:74296235-74296257 AACTACCACCTAATGATATTGGG - Intergenic
1014017538 6:116550543-116550565 AGCTAACAGTTACTGATACTAGG - Intronic
1016741034 6:147528709-147528731 ATCTAACAGCTGATGAAACTAGG + Intronic
1020500886 7:8918728-8918750 ATCTATCATTCAATGATTCTGGG - Intergenic
1024878427 7:54054868-54054890 ATCTCTCAGATCAAGATACTGGG - Intergenic
1030710592 7:112744234-112744256 ATATATAGGGTAATGATACTTGG - Intergenic
1030855707 7:114554421-114554443 AGCTATTGGCTAATGAAACTTGG + Intronic
1031275584 7:119717844-119717866 ATTTATCAGTCAATGATTCTTGG - Intergenic
1036729375 8:11248956-11248978 ATCACCCAGCTAATGATACAAGG + Intergenic
1041846350 8:62333755-62333777 TGCTTTCAGATAATGATACTAGG - Intronic
1042046490 8:64658141-64658163 ATCTATAAGGTAATGATGTTAGG - Intronic
1042208455 8:66352611-66352633 AACTATCAGCAAAGGATACCAGG - Intergenic
1044905548 8:96997542-96997564 ATCTCTCAACTAATGTTATTTGG - Intronic
1052185884 9:25593757-25593779 ATCTATCAAATATTGCTACTGGG - Intergenic
1187959671 X:24556615-24556637 TTCTATCAGCTACAGATATTTGG + Intergenic
1189431788 X:40953460-40953482 ATGTATCAGCTAATGATTTCAGG - Intergenic
1191954808 X:66632675-66632697 ATGTGTCAGCTATTGATACTGGG + Intronic
1193246363 X:79235060-79235082 ATTTATCAGCTAAATATAATGGG - Intergenic
1195152189 X:102083453-102083475 CTCTATCAGCTCCTGATTCTAGG + Intergenic
1199361448 X:146924167-146924189 ATTTATCAACAAATGGTACTAGG - Intergenic
1200838929 Y:7760659-7760681 ATACATAAGCTAATGAAACTAGG - Intergenic