ID: 1067959696

View in Genome Browser
Species Human (GRCh38)
Location 10:50834296-50834318
Sequence TCACTTTCCTCCCTCAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 218}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067959696_1067959703 19 Left 1067959696 10:50834296-50834318 CCTGCATTGAGGGAGGAAAGTGA 0: 1
1: 0
2: 2
3: 15
4: 218
Right 1067959703 10:50834338-50834360 TGGAGGTAGGTTTCTCAAGAAGG No data
1067959696_1067959704 25 Left 1067959696 10:50834296-50834318 CCTGCATTGAGGGAGGAAAGTGA 0: 1
1: 0
2: 2
3: 15
4: 218
Right 1067959704 10:50834344-50834366 TAGGTTTCTCAAGAAGGTGCTGG No data
1067959696_1067959701 2 Left 1067959696 10:50834296-50834318 CCTGCATTGAGGGAGGAAAGTGA 0: 1
1: 0
2: 2
3: 15
4: 218
Right 1067959701 10:50834321-50834343 AATTCGGGCTGGAATACTGGAGG No data
1067959696_1067959700 -1 Left 1067959696 10:50834296-50834318 CCTGCATTGAGGGAGGAAAGTGA 0: 1
1: 0
2: 2
3: 15
4: 218
Right 1067959700 10:50834318-50834340 ACTAATTCGGGCTGGAATACTGG No data
1067959696_1067959699 -9 Left 1067959696 10:50834296-50834318 CCTGCATTGAGGGAGGAAAGTGA 0: 1
1: 0
2: 2
3: 15
4: 218
Right 1067959699 10:50834310-50834332 GGAAAGTGACTAATTCGGGCTGG No data
1067959696_1067959705 29 Left 1067959696 10:50834296-50834318 CCTGCATTGAGGGAGGAAAGTGA 0: 1
1: 0
2: 2
3: 15
4: 218
Right 1067959705 10:50834348-50834370 TTTCTCAAGAAGGTGCTGGCTGG No data
1067959696_1067959706 30 Left 1067959696 10:50834296-50834318 CCTGCATTGAGGGAGGAAAGTGA 0: 1
1: 0
2: 2
3: 15
4: 218
Right 1067959706 10:50834349-50834371 TTCTCAAGAAGGTGCTGGCTGGG No data
1067959696_1067959702 6 Left 1067959696 10:50834296-50834318 CCTGCATTGAGGGAGGAAAGTGA 0: 1
1: 0
2: 2
3: 15
4: 218
Right 1067959702 10:50834325-50834347 CGGGCTGGAATACTGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067959696 Original CRISPR TCACTTTCCTCCCTCAATGC AGG (reversed) Intronic
900346759 1:2213916-2213938 ACGCTTTCCTCCCTCCGTGCCGG + Intergenic
902813102 1:18900740-18900762 TCTCTTTCCCCTCTCAATTCAGG + Intronic
908356758 1:63330007-63330029 TCCCTTCCCTCCCTCCAGGCAGG - Intergenic
910736272 1:90461379-90461401 CCTCTTACCTCCCTCAAAGCAGG + Intergenic
911104506 1:94119291-94119313 TCACTTTCCTCTGTCAAGCCTGG - Intronic
911208973 1:95119719-95119741 TCATGTTCCTCTCTCAAAGCTGG + Intronic
911629729 1:100169391-100169413 ACACTTTCCTTCATCAATGGTGG + Intronic
912616825 1:111110323-111110345 TCACTCTCCTTCCCCAAAGCAGG + Intergenic
912820350 1:112862826-112862848 TCCCTTTTCTCCCCCAAGGCAGG + Intergenic
915766667 1:158369990-158370012 TCAGCTACCTCCCTAAATGCTGG - Intergenic
917467440 1:175293749-175293771 TCACTTGCCTCCCAAAGTGCTGG - Intergenic
917483148 1:175430675-175430697 GAACCTTCCTCCTTCAATGCTGG + Intronic
918378100 1:183929172-183929194 TGCCTTTCCTCCCTCCATGGAGG - Intergenic
920270972 1:204763593-204763615 TCAATTTCCTCCCCAAAAGCTGG + Intergenic
923155572 1:231276017-231276039 TCAATTGCCTTCCTCAAGGCTGG - Intronic
924778699 1:247128779-247128801 TCAGGTTCCTGCCTCACTGCGGG - Intronic
924782955 1:247169639-247169661 TCAGGTTCCTGCCTCACTGCGGG + Intronic
1064686637 10:17868470-17868492 TCACTTCCCTCCCTCAATGTGGG + Intronic
1065064254 10:21943831-21943853 TCACTTTCCTGACTATATGCAGG - Intronic
1065433458 10:25682917-25682939 ACAGCTTCCTCCTTCAATGCTGG + Intergenic
1067959696 10:50834296-50834318 TCACTTTCCTCCCTCAATGCAGG - Intronic
1071180724 10:82980423-82980445 TCACTTCCCTCACTCAAGCCAGG + Intronic
1071234716 10:83631870-83631892 TCACATTCCTCCTTCAGTGGTGG - Intergenic
1072664422 10:97383571-97383593 GCCCTTGCCTCCCTCCATGCAGG + Intronic
1073774572 10:106771442-106771464 TGACTTTCTTGCCTCAATACAGG - Intronic
1074730531 10:116368635-116368657 TTACATACCTCCCTCAATCCTGG + Intronic
1076686259 10:132199732-132199754 TCAGTTTCAACCCTCGATGCAGG - Intronic
1078549777 11:12272088-12272110 TCTCTTTCCTCCTTCCATGGAGG - Intergenic
1078554195 11:12305382-12305404 TCACTTCCCTCTCTCAATATGGG + Intronic
1079671033 11:23171527-23171549 TTACTTGCCTTCCTGAATGCAGG + Intergenic
1079817609 11:25081284-25081306 TCAGTCTCCTCCCAAAATGCTGG + Intronic
1080945750 11:36972091-36972113 TGACCTTCCTCCCTCAATGAGGG - Intergenic
1082009763 11:47442092-47442114 TCACTTTCCACCCACCTTGCTGG - Intronic
1083792783 11:64996700-64996722 TCACTTTCCTCCCCCGAAGTCGG - Intronic
1089540700 11:119187718-119187740 CCACTCTCCTCCCCCAATCCGGG + Intronic
1090387315 11:126364627-126364649 TCCATTTCCTCCCTCACTCCTGG + Intronic
1090389879 11:126381825-126381847 TCCATTTCCTCCCTCACTCCTGG + Intronic
1090581311 11:128162943-128162965 TCTCTTTCCTCTCTCACTGATGG - Intergenic
1090736827 11:129617948-129617970 CCACTTTTCTCCCTCCAGGCTGG + Intergenic
1090967000 11:131607527-131607549 TTTCTTTCTTCCCTCAATGATGG + Intronic
1091388898 12:113099-113121 CCACTTCCTTCCCTCCATGCTGG + Intronic
1092077623 12:5686453-5686475 TCAATTCCCTCCCTCAATGAGGG + Intronic
1093777913 12:23099074-23099096 TCTCTCTCCTCCCTCAGGGCAGG + Intergenic
1096463616 12:51836406-51836428 TCACGTTTCTCCCTCTCTGCTGG - Intergenic
1096529447 12:52233854-52233876 TCCCTTTCCTCCCGGAGTGCGGG + Intronic
1098032962 12:66273191-66273213 GCCTTTTCCTTCCTCAATGCAGG - Intergenic
1098228520 12:68349300-68349322 TGACTTTCCTCTCACAATGTAGG - Intergenic
1098613904 12:72498568-72498590 TTACTCTCCTCCTTCAATGAAGG + Intronic
1099098928 12:78412184-78412206 TCACCTTCCACCCTCAAAGTAGG - Intergenic
1099731165 12:86505310-86505332 TCCATTTCCTTTCTCAATGCAGG + Intronic
1100116892 12:91316724-91316746 TCAATATCCTCCTTCCATGCTGG + Intergenic
1101492814 12:105225080-105225102 TCACTTTCCTTCAGCAAAGCAGG - Intronic
1101538597 12:105643434-105643456 TCACCTGCCTCCCACAGTGCTGG + Intergenic
1105039207 12:132948669-132948691 TAACTTTCCTCCCTCATTTGAGG - Intronic
1106762461 13:32880626-32880648 CCACCTCCCTCCCTCACTGCAGG - Intergenic
1107247591 13:38315690-38315712 TCAATTTTTTCCCTCAGTGCAGG + Intergenic
1107851515 13:44576899-44576921 GCATTTTCCTCCCTCAGGGCAGG + Intronic
1108482156 13:50884410-50884432 TCGCTTTCCTCACTCCTTGCAGG - Intergenic
1108717833 13:53099430-53099452 TCACTTTCCTGGCTCCTTGCAGG - Intergenic
1109139256 13:58693348-58693370 TCACTATACTCCCACCATGCTGG + Intergenic
1109637494 13:65141562-65141584 TCATTTTCCTCCCTCAGGCCTGG - Intergenic
1112798444 13:103083619-103083641 TCACTTTCCTTCCTAAGTCCTGG + Intergenic
1113538928 13:111091873-111091895 TCACTCTCCTACCTCTAGGCTGG - Intergenic
1113777947 13:112959493-112959515 TGACCCTCCTCCCTCACTGCAGG - Intronic
1114643165 14:24238217-24238239 TCTCTTTCCCCCCTCCATGATGG + Intronic
1114693530 14:24606842-24606864 TCACTCACCTCCCTCAGTCCTGG + Intronic
1117019360 14:51553635-51553657 TCCCTTTCCTACCTCTAGGCAGG - Intronic
1121484556 14:94304651-94304673 TCGCTTTCCTGACTCATTGCTGG + Intronic
1123970811 15:25506418-25506440 TCAATTTCCTCCCTGAATATAGG - Intergenic
1124551404 15:30684186-30684208 TGCCTTTCCTTCGTCAATGCAGG - Intronic
1124679844 15:31721479-31721501 TGCCTTTCCTTCGTCAATGCAGG + Intronic
1125384740 15:39125257-39125279 TCAATTTACTCCCTCAACGTGGG + Intergenic
1126980461 15:54237067-54237089 TCATTTTCTTCACTCGATGCTGG - Intronic
1127607889 15:60608155-60608177 TCCCTTTCCTCCGTCTATGCAGG - Intronic
1128917011 15:71572444-71572466 CCACTTTCTTCCCTGCATGCTGG + Intronic
1129232801 15:74206061-74206083 TCACTGTCCTCTCTCAAATCCGG + Intronic
1131147047 15:90020788-90020810 TCCCTCTCCTCCCTGAATGGCGG + Intronic
1131620348 15:94061707-94061729 GCACTTTCCTCTCTAAATTCAGG + Intergenic
1131753315 15:95533466-95533488 TCACGTGCCTCCATCAATGTGGG - Intergenic
1132009635 15:98265097-98265119 TCAGGGTCCTCCTTCAATGCAGG - Intergenic
1132113439 15:99118874-99118896 TCCCTTTCCTCCTGCATTGCGGG + Intronic
1133328343 16:4956110-4956132 TCATTGTCCTCCCTCAATGTTGG + Intronic
1133850639 16:9500163-9500185 TCTCTGCCCTCCCTCACTGCTGG + Intergenic
1135913257 16:26580151-26580173 TCACTCTCCTCCCTCCCTCCAGG + Intergenic
1142320273 16:89377747-89377769 TCACAGTCCTCCCTCACTGTTGG - Intronic
1142402628 16:89868612-89868634 TCACTGGCCTCCCAAAATGCTGG - Intronic
1143238060 17:5420000-5420022 AGACTTACCTCCCTCAGTGCAGG + Exonic
1143265371 17:5632847-5632869 TCAGTTTCCTCACCCAAAGCCGG + Intergenic
1143555019 17:7654606-7654628 TCACCTTCCACCCTCACTCCAGG + Exonic
1143948911 17:10617587-10617609 TCACTTGCCTCCCTCTAGTCCGG - Intergenic
1144075888 17:11719139-11719161 TCACAGTGCTCCCTCCATGCAGG - Intronic
1145055744 17:19702999-19703021 TCACATTCCTGGCTCAGTGCTGG - Intronic
1145907679 17:28525138-28525160 CCACTTGCCCCCCTCCATGCTGG - Intronic
1149188185 17:54027015-54027037 TCACTTACCTGGCACAATGCTGG + Intergenic
1152545649 17:80998950-80998972 TCACTTGCCTCCCCCAGAGCTGG + Intronic
1153824213 18:8860428-8860450 TCACTTTTCTCCCTCTTTGCTGG + Intergenic
1154079926 18:11246202-11246224 TCACTTTTCTCCTGCAAAGCTGG - Intergenic
1156161317 18:34361716-34361738 TCACTGTCCTCCAGCCATGCAGG + Intergenic
1157048699 18:44134790-44134812 TCACTTTCTTGCCTGAAAGCTGG - Intergenic
1157712717 18:49860965-49860987 TGCCTCTCCTCCCTCAATGCTGG + Intronic
1157952918 18:52060525-52060547 TCTCTTTTCTCCTTCAATTCAGG + Intergenic
1158522425 18:58182925-58182947 TCCCTCTCCTCCCTCACTGCTGG + Intronic
1159554702 18:69933070-69933092 GCAGTGTCCTCCCTCACTGCAGG + Intronic
1159702108 18:71641536-71641558 TCCCTTTCCTTCCTCCATGCAGG + Intergenic
1160400494 18:78607457-78607479 TCATTTCCCTCCACCAATGCCGG + Intergenic
1162950953 19:14072097-14072119 TCTCCCTCCTCCCTCAATCCGGG + Intergenic
1163062572 19:14771138-14771160 TCACTTTCCTCCCACCAGGGAGG + Intronic
1168238180 19:55076330-55076352 CCAGCCTCCTCCCTCAATGCAGG - Intronic
926128836 2:10287641-10287663 TCACTGGCCTCCCCCAATCCTGG - Intergenic
928257621 2:29737844-29737866 CCATTTTCCACCCTCCATGCAGG - Intronic
929457037 2:42073364-42073386 TCACCTTCCTTCCTCAATTGAGG - Intergenic
930607644 2:53509093-53509115 TCACTTTCCTCCCTCGACTCGGG + Intergenic
932000100 2:67877359-67877381 TCACCTCCCTCCCTCAAACCAGG + Intergenic
932976850 2:76613079-76613101 TCACTTTTCTCACTCAATAAAGG - Intergenic
935220176 2:101005193-101005215 TCTCTTTCCTCTATCGATGCCGG - Intronic
935656811 2:105430315-105430337 TTCCTTTCCTCCCTTAAAGCAGG + Intronic
935762215 2:106331752-106331774 TCAGTTTCCTCACTCAGTGCTGG - Intergenic
938787013 2:134639056-134639078 TCCCTTTCCTCCTTAAATGTTGG - Intronic
945831924 2:214797844-214797866 TCTCTTTGCTCACTCACTGCAGG - Intronic
947523749 2:230866235-230866257 TCTCAGTCCTGCCTCAATGCGGG - Intronic
948074343 2:235154267-235154289 AAACTGTCCTCCCACAATGCAGG - Intergenic
1168811172 20:705572-705594 TCACGTTCCTCTCTAAAAGCTGG - Intergenic
1169182389 20:3580990-3581012 TCACTGGCCTCCCAAAATGCTGG - Intronic
1170813643 20:19695021-19695043 TCACTTTCCTCCCTGGAGACCGG + Intronic
1173178527 20:40783823-40783845 TCATCTTCCTCCCTCAAACCTGG + Intergenic
1175572901 20:60037438-60037460 TCCCTTTCTTCCCTCAAAGAGGG - Intergenic
1176443479 21:6799069-6799091 TCACTTTTCAGCCTCATTGCTGG - Intergenic
1176821647 21:13664116-13664138 TCACTTTTCAGCCTCATTGCTGG - Intergenic
1177232280 21:18337658-18337680 TCAGTTTCCTCCCTCTTTCCTGG - Intronic
1177257775 21:18688839-18688861 ACAGTTTCCTCAGTCAATGCAGG - Intergenic
1179434706 21:41352280-41352302 GCACATGCCTCCCTCCATGCAGG + Intronic
1179655794 21:42843806-42843828 CCACTGTCCTCCCAAAATGCTGG + Intronic
1181032578 22:20155437-20155459 ACACTTTCCGCCCTCGAGGCCGG - Intergenic
1181098714 22:20524392-20524414 TCCCTGTCCTCCATCAGTGCAGG - Intronic
953008918 3:39005324-39005346 TCTCTCTCTTCCCTCAATACAGG + Intergenic
953240423 3:41143919-41143941 TTTCTTTCCTCCCTCACTTCTGG - Intergenic
953271719 3:41452036-41452058 TCACCTTCCTCCCTGATTACTGG + Intronic
953613558 3:44469006-44469028 TCACTATCCTCCCAAAATACTGG - Intronic
955693945 3:61616912-61616934 TGACTTTCCACCATCGATGCCGG + Intronic
961077504 3:123995605-123995627 TCACTTCCCTCCAGCCATGCTGG + Intergenic
961307075 3:125965680-125965702 TCACTTCCCTCCAGCCATGCTGG - Intergenic
961429106 3:126867794-126867816 TCTCTGTCCTCCCTCCATGATGG + Intronic
962390881 3:134971626-134971648 TCCTTCTCCTTCCTCAATGCAGG + Intronic
962810117 3:138952283-138952305 TCAATTTTCTCCCACAAAGCGGG + Exonic
963269442 3:143271290-143271312 TCACTTGGCTCCCTCTGTGCAGG + Intronic
963405032 3:144853109-144853131 CCAGTTTCCTCCCTCAACACTGG - Intergenic
964908348 3:161746121-161746143 TTACTTTCCTCCTTCACTTCAGG + Intergenic
965113216 3:164453034-164453056 TCACTTTCCTGCTTCATTCCTGG - Intergenic
965240029 3:166184776-166184798 TAACTTTCCTACCTTATTGCTGG - Intergenic
969572027 4:8014721-8014743 TCACTTAAATCCCTCCATGCTGG + Intronic
970531697 4:16991679-16991701 TCACTTTTCTCCCACGAAGCAGG - Intergenic
972040151 4:34584038-34584060 TCAATTTCCTCCCTGAAGGCAGG + Intergenic
973588296 4:52413999-52414021 GCAGTGGCCTCCCTCAATGCAGG - Intergenic
976248643 4:83028353-83028375 TGCCTTTCCTCCCAAAATGCTGG - Intergenic
978120992 4:105079269-105079291 TACCTTTCCTCCCTCAATTTGGG - Intergenic
980815965 4:137946717-137946739 GCACATCCCTCCCTCCATGCAGG - Intergenic
982663364 4:158231293-158231315 TCACCTTTCTCCCACAAAGCAGG - Intronic
983596736 4:169476225-169476247 TCACCTCCCTCCCTCAACACAGG - Intronic
986320953 5:6632751-6632773 TCTCTTTCCTTCCTCAGGGCTGG - Exonic
986632385 5:9786197-9786219 CCACTGTCCTCCCTCAACTCAGG - Intergenic
988260315 5:28878108-28878130 TCCCTTTACTTCCTCAATTCAGG - Intergenic
991385544 5:66084894-66084916 TCACTTTTCTCCCAAAGTGCTGG + Intergenic
996126261 5:119728381-119728403 CCAGGTCCCTCCCTCAATGCAGG - Intergenic
996856734 5:128016546-128016568 TCCCTTTCCTCCCCCTAGGCCGG + Intergenic
998012324 5:138705186-138705208 TCATCTTACTCCCTCAAGGCAGG - Intronic
999190763 5:149745550-149745572 TCTCTTTCCTGCCTCAGTGTGGG + Intronic
1001889193 5:175324887-175324909 TCAGCTTCCTCCTTAAATGCAGG + Intergenic
1003255740 6:4473221-4473243 TCACTTTCCTCGATAAATACTGG + Intergenic
1005488391 6:26322915-26322937 TTATTTTCCTTCCTCAAAGCTGG + Intergenic
1006223624 6:32517752-32517774 ACACTTTCCTCTCTCTCTGCAGG - Exonic
1006833767 6:36985042-36985064 CCACTCCCCTCCCCCAATGCTGG + Intronic
1006941808 6:37756583-37756605 TCACCTCCCTCCCTCCATCCTGG + Intergenic
1007252060 6:40502498-40502520 TCCCTCCCCTCCCTCCATGCTGG + Intronic
1007340122 6:41186051-41186073 TCACTTTCCTCCCACCATCCCGG - Intergenic
1007462176 6:42026799-42026821 TCACTTTCCTCCCTCCCCACTGG + Intronic
1007748753 6:44059068-44059090 TCCCTGTCCTTCCTCACTGCTGG + Intergenic
1008373915 6:50769599-50769621 TCACTTTCCTGCCTAAGAGCAGG - Intronic
1010080228 6:71853072-71853094 TCACATTTCCCCCTGAATGCTGG - Intergenic
1010637695 6:78281915-78281937 CCACTTACCTCTGTCAATGCTGG - Intergenic
1014522749 6:122465502-122465524 TCACTTGCCTTCCAGAATGCAGG + Intronic
1015350140 6:132209290-132209312 TCCCTTTCCCCCCTCCTTGCGGG + Intergenic
1015561118 6:134517174-134517196 TCACTTTACTTCTTCAAGGCAGG - Intergenic
1015605082 6:134945875-134945897 TCACTTTCCTCCCTCAACACAGG - Intronic
1015870614 6:137772747-137772769 CCACTGCCCTCCCCCAATGCGGG - Intergenic
1015992774 6:138964276-138964298 CCACTTTCCTACCTCAGTGAGGG + Intronic
1016497770 6:144683644-144683666 TCACTTTTCTCTCTAAATGTTGG + Intronic
1018254993 6:161909685-161909707 ATACTTTCCTCCCTAAAAGCAGG + Intronic
1018257948 6:161941157-161941179 TCATTTTCCTGCCCCAATGTTGG + Intronic
1020071441 7:5229590-5229612 TCGCTTTCTTCCCTCCAGGCTGG + Exonic
1021607120 7:22419269-22419291 TCACTTTCCTGGCACGATGCTGG - Intergenic
1024159434 7:46659209-46659231 ACACTTTCCTCAGGCAATGCAGG + Intergenic
1024457800 7:49629096-49629118 TCACTTTCCTGCTACAAGGCTGG + Intergenic
1026770858 7:73197654-73197676 TCTCTTTCCATCCTCAATTCTGG + Intergenic
1027261215 7:76465875-76465897 TCACTTTACCCCCTCCCTGCCGG - Intronic
1027312599 7:76963983-76964005 TCACTTTACCCCCTCCCTGCCGG - Intergenic
1027958816 7:84917529-84917551 TCAGTTGCCTACCACAATGCTGG + Intergenic
1029147718 7:98458577-98458599 TCATTGTCCTCCCTCACTTCAGG - Intergenic
1029228912 7:99049961-99049983 TCACTTGCCTCCCAGAGTGCTGG - Intronic
1030326347 7:108222708-108222730 TCACATTCCTTCCTGAATCCAGG - Intronic
1032653422 7:133903126-133903148 TCACTTTACTCCAACCATGCTGG - Intronic
1033355656 7:140597338-140597360 TGGCTTTCCTCCCTCAAAGAGGG + Intronic
1034354554 7:150442464-150442486 CCACATTCCTCCCTCCTTGCTGG - Intergenic
1034554882 7:151844084-151844106 TCAGTTTCCTCCCACACTCCAGG + Intronic
1037116547 8:15236162-15236184 TCACTGTCCTCCCTCCGTCCTGG + Intronic
1037269597 8:17112085-17112107 TCACTTCCCTCCCTCAACATGGG + Intronic
1039788770 8:40857101-40857123 TCACTTGCCTCCCTCCCTCCAGG - Intronic
1039944603 8:42118594-42118616 TCATTTTCCTACCCCACTGCTGG + Intergenic
1041388667 8:57330066-57330088 TCCCTTTCCTCCATCCAAGCTGG - Intergenic
1043762413 8:84084229-84084251 TCACTTACCTCTCTCGATCCTGG - Intergenic
1044068608 8:87727431-87727453 TCACCTTCCTCCCTCAACACAGG - Intergenic
1046674915 8:117096747-117096769 TCACTTTGCTCCATCTTTGCAGG - Intronic
1048676457 8:136788378-136788400 TCAGGTTCCTCCCTCAACACGGG - Intergenic
1051740235 9:20244386-20244408 TCTCTTTTATCCCTCAGTGCTGG - Intergenic
1052444814 9:28546688-28546710 TCCCTTTTCTCCCTCAAGGCAGG - Intronic
1057283497 9:93729224-93729246 TCACCTTCCTCCCTGCCTGCTGG + Intergenic
1058381162 9:104378639-104378661 TCACTTTCCTCCTCCACTGATGG - Intergenic
1058596811 9:106623641-106623663 TCAATTTTCTCCCACAATGATGG - Intergenic
1058912994 9:109538126-109538148 TGATTTTCCTCCCTTAATGTTGG + Intergenic
1059468913 9:114488675-114488697 TTTCTGTCCTCCCTCAAAGCAGG - Intronic
1059970377 9:119661516-119661538 TCACTTTCCTCTTTTATTGCAGG + Intergenic
1203525722 Un_GL000213v1:85458-85480 TCACTTTTCAGCCTCATTGCTGG + Intergenic
1203655390 Un_KI270752v1:19192-19214 TCACTTTCCTACCACACTGTTGG - Intergenic
1188661253 X:32761652-32761674 CTACTCTCCTCCCTCAAAGCGGG - Intronic
1190142196 X:47857635-47857657 TCACTTTTCCCCTTCTATGCTGG + Intronic
1190751442 X:53365341-53365363 TTACTTTTTTCTCTCAATGCTGG + Intergenic
1192156257 X:68748874-68748896 TGCCTTTCCTCCTTTAATGCAGG + Intergenic
1192173215 X:68869711-68869733 TCAATTTCCTCCCTCTAAACTGG + Intergenic
1194436644 X:93875011-93875033 TCCCTTTTATCCCTCAATGATGG - Intergenic
1195310112 X:103624452-103624474 TCATTTTTCTCCCTAAATGGTGG - Intronic
1195311705 X:103638437-103638459 TCATTTTTCTCCCTAAATGGTGG - Intergenic
1195427635 X:104752692-104752714 TGAGTTTTCTCCCTCAAAGCAGG + Intronic
1195872580 X:109501551-109501573 TCACTTACTTCCCTAATTGCTGG + Intergenic
1196256392 X:113524177-113524199 CCACTTTCTTCCTTCAATGTTGG + Intergenic
1198795427 X:140389296-140389318 GCACTTTCCTCCTCCAAGGCAGG - Intergenic
1198839134 X:140837551-140837573 TCACATACCTCCCTCAATTCTGG - Intergenic
1200744420 Y:6891089-6891111 TCTCTCTCTTCCCTCACTGCAGG - Intergenic