ID: 1067959704

View in Genome Browser
Species Human (GRCh38)
Location 10:50834344-50834366
Sequence TAGGTTTCTCAAGAAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067959696_1067959704 25 Left 1067959696 10:50834296-50834318 CCTGCATTGAGGGAGGAAAGTGA 0: 1
1: 0
2: 2
3: 15
4: 218
Right 1067959704 10:50834344-50834366 TAGGTTTCTCAAGAAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067959704 Original CRISPR TAGGTTTCTCAAGAAGGTGC TGG Intronic
No off target data available for this crispr