ID: 1067960947

View in Genome Browser
Species Human (GRCh38)
Location 10:50848784-50848806
Sequence GGACCCAAGGGAACAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067960947 Original CRISPR GGACCCAAGGGAACAGGAGC AGG (reversed) Intronic
900396601 1:2455612-2455634 GGACCCCAGGGAACAAGCGTCGG - Intronic
900426524 1:2582667-2582689 GGACCCAAGCAAAACGGAGCTGG - Intergenic
900718865 1:4162193-4162215 GGGCTCAAGGGCACAGGGGCAGG - Intergenic
900889773 1:5441508-5441530 GGAGCCAGGGGCTCAGGAGCCGG + Intergenic
900963353 1:5939913-5939935 GGACCCCAGGGCACAGAAGGAGG + Intronic
901144734 1:7057268-7057290 GGACCCAGGGGAACCGGGACGGG - Intronic
904937748 1:34143773-34143795 AGACCCAAGGCAAGAGGAGCAGG - Intronic
905238425 1:36566192-36566214 GGGCCCAAGGGAATCTGAGCAGG - Intergenic
906209608 1:44005183-44005205 AGACCCTGGGGGACAGGAGCTGG + Intronic
906886411 1:49653172-49653194 GGACCCAAGTGAATAGGGTCTGG + Intronic
907941116 1:59088309-59088331 GAATCCAAGGGAACAGAAGTAGG - Intergenic
907976283 1:59434491-59434513 GGGCCCAAGGGAACTAGAGAGGG + Intronic
910536812 1:88307478-88307500 GGGCCAAAGGGAACAGGTGATGG + Intergenic
912135889 1:106659785-106659807 GGCCTTAAGGGAACAGTAGCTGG + Intergenic
913112749 1:115671120-115671142 GGACTCACAGGAAAAGGAGCTGG + Intronic
913234074 1:116765303-116765325 GCAGCCAAGGGAACAGGCCCTGG + Intronic
914229194 1:145749377-145749399 GAATCCAAGTGAAGAGGAGCTGG - Intronic
914239960 1:145846651-145846673 GGACCCAAGAGAACTGGCCCTGG - Exonic
915507921 1:156369095-156369117 GGGCCCCGGGGACCAGGAGCGGG - Intergenic
915990719 1:160512714-160512736 GGACCCAGGTGAATAGGATCTGG + Intronic
916053030 1:161049242-161049264 GGAGTCCAGGGAACAGCAGCTGG + Exonic
916934497 1:169613608-169613630 GAATCCAGGGTAACAGGAGCAGG + Exonic
917014145 1:170510867-170510889 GAACCCAAGGGAACAGAAGATGG - Intergenic
917735113 1:177913210-177913232 GGACCAAAGGGCACAGCAGTTGG - Intergenic
918216092 1:182392420-182392442 AGACCCAAGAGAGCCGGAGCGGG - Intergenic
918595295 1:186286315-186286337 GGACCAAAGGGTACAGGACAAGG - Intergenic
919231563 1:194780383-194780405 GGATCCAAGTGAACAGGGTCTGG + Intergenic
919377972 1:196817725-196817747 GGACCCACCGAACCAGGAGCAGG + Intergenic
919844255 1:201631143-201631165 GGCTCCTAGGGAAGAGGAGCAGG + Intronic
919991315 1:202710028-202710050 GGACCCGAGGGGCGAGGAGCCGG - Intronic
921675140 1:217968365-217968387 GGAGGCCAGGGAGCAGGAGCAGG - Intergenic
921753610 1:218826264-218826286 GAAGACAAGGGATCAGGAGCTGG - Intergenic
922096773 1:222449697-222449719 GGACCTAGGGGATCAGCAGCTGG - Intergenic
924862767 1:247942884-247942906 GGACCCCAGGGAATGGGAGAAGG - Intronic
1064016738 10:11778798-11778820 GGCCATCAGGGAACAGGAGCAGG + Intergenic
1065724013 10:28652942-28652964 GTAACCTAGGGAACATGAGCAGG + Intergenic
1066011826 10:31201589-31201611 GGACCAAAGGAGACAGAAGCAGG - Intergenic
1066183050 10:32981815-32981837 GGACCCCAGGGAATAGGATCTGG + Intronic
1066568821 10:36749177-36749199 GCATGGAAGGGAACAGGAGCAGG - Intergenic
1066662851 10:37753401-37753423 GGCCCCAAGGGCACATGAGGAGG - Intergenic
1067224873 10:44369079-44369101 GGACCTCAGGAAACAGGAGGTGG + Intergenic
1067960947 10:50848784-50848806 GGACCCAAGGGAACAGGAGCAGG - Intronic
1068096696 10:52499868-52499890 GGATCCAACGGGAGAGGAGCAGG - Intergenic
1069570372 10:69491170-69491192 GAACCCAGGGGACCAGGAGAAGG - Intronic
1070948843 10:80414651-80414673 GGACCCAAGTCAACAGGAATAGG - Intronic
1070953808 10:80451776-80451798 GGACCCAGGGGAACCAAAGCAGG - Intergenic
1072101246 10:92231486-92231508 GGACAGAAGGGAAAAGGAGGAGG - Intronic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1072637594 10:97187627-97187649 GGGCCCCATGGAGCAGGAGCTGG - Intronic
1073233900 10:101996966-101996988 AAACCCAAGGGAATAGGGGCTGG + Intronic
1073633899 10:105177670-105177692 GGACCCAATGGAAAGGGAGGGGG - Intronic
1073734509 10:106330512-106330534 GGACCAAAAGGACCAGGTGCAGG + Intergenic
1074722334 10:116273478-116273500 GGAGCGGCGGGAACAGGAGCAGG - Intergenic
1074971632 10:118544022-118544044 GGACGCCAGGGAAGAGGAGAAGG - Intergenic
1076361463 10:129892258-129892280 GCCCCCAAGGAAACAGGAGAGGG + Intronic
1076752727 10:132551772-132551794 GGACCCAGGGGGACAGAGGCAGG + Intronic
1077091295 11:779531-779553 GGACCCAAGGGTACACTAGGGGG - Intronic
1078303241 11:10156117-10156139 AGAGGCCAGGGAACAGGAGCAGG - Intronic
1079175338 11:18135073-18135095 GGACTCCAGGGACCAGGGGCTGG + Intronic
1079249219 11:18774854-18774876 GGATGGAAGGGAACAGGAGGAGG + Intronic
1079276357 11:19040821-19040843 GGACCCAGGTGAATAGGGGCTGG + Intergenic
1079564279 11:21862519-21862541 GTTCCCAAGGGAACAGTAGAAGG - Intergenic
1081866056 11:46361396-46361418 GGAACCTTGGGAAAAGGAGCTGG + Intronic
1082927941 11:58570632-58570654 TGATCCAGGGGAAGAGGAGCTGG + Exonic
1083625557 11:64070304-64070326 GGCCCCCAGGGAACATGAGGAGG - Intronic
1084490580 11:69476268-69476290 GGGCCCCAGGGAAGGGGAGCCGG - Intergenic
1084545032 11:69810953-69810975 GGAACCCAGAGAGCAGGAGCTGG - Intronic
1084625639 11:70304298-70304320 GGACCCAGGTGAACAGCAGAAGG - Intronic
1084752425 11:71213024-71213046 GGAGGCAAAGGAAGAGGAGCAGG + Intronic
1085529521 11:77183236-77183258 GGGCCCACGGAAGCAGGAGCAGG + Intronic
1087130153 11:94662316-94662338 GGACCCGAGGGAACAGCATTAGG + Intergenic
1089304433 11:117517708-117517730 TGACCCAAGGGCAGAGGAGCAGG - Intronic
1090856906 11:130617770-130617792 GGAGTCGAGGGAACAGGAGGAGG + Intergenic
1091526452 12:1306140-1306162 TGAGCCAAAGCAACAGGAGCTGG - Intronic
1093051472 12:14509675-14509697 GGACCCTAGGGATCAGGACCTGG - Intronic
1094309772 12:29066966-29066988 GGACACATGGGCACAGTAGCTGG + Intergenic
1096199829 12:49673614-49673636 GGGGCCAAGGCAGCAGGAGCTGG - Intronic
1097317177 12:58184393-58184415 GGAGCCAAGGGCAGAGGAGAGGG - Intergenic
1097498544 12:60373898-60373920 GGACCCAAGTGAATAGGGTCTGG + Intergenic
1098830047 12:75350553-75350575 GGACCCAGGTGAACAGGGTCTGG + Intronic
1102513815 12:113433633-113433655 GGACCCAAGGCAACCACAGCAGG - Intronic
1102987857 12:117293160-117293182 GGAGCCTGGGGAACAGGAGGTGG + Intronic
1104946129 12:132415621-132415643 GGACCCCAGGGCACGGGAGACGG - Intergenic
1105214880 13:18278250-18278272 GGACCCCAGGCAACGGAAGCAGG + Intergenic
1106138048 13:26989419-26989441 GGACTCAACGGAAGAGGAGGCGG + Intergenic
1106859926 13:33894536-33894558 TCAGCCAAGGGTACAGGAGCTGG + Intronic
1107343397 13:39433924-39433946 AGAGCCAGGGAAACAGGAGCAGG - Intronic
1107374197 13:39784641-39784663 GAATCTAAGAGAACAGGAGCTGG - Intronic
1110852708 13:80263084-80263106 GGATCCAATGGGACAGGAGCAGG - Intergenic
1111706698 13:91758937-91758959 GAACCAAAGGGCACAGGAGTAGG - Intronic
1112301964 13:98239200-98239222 AGCCCCAAGGGAACAAGTGCCGG + Intronic
1113400606 13:109989257-109989279 GCACCCCAGGGAGCTGGAGCTGG - Intergenic
1115643426 14:35350200-35350222 GGCCCCAAGGAAACACGTGCTGG - Intergenic
1116791680 14:49346179-49346201 GGACCCAAGGGCACAACAGGTGG + Intergenic
1118248666 14:64136911-64136933 TGAGCCAAGGGAAAAGGAGAGGG + Intronic
1118385352 14:65251626-65251648 GGTCCCAGGGGCAAAGGAGCAGG - Intergenic
1118817886 14:69325553-69325575 TGACACCAGGGAACAGGACCAGG - Intronic
1118824100 14:69364809-69364831 GGAGCCAAAGGAAGGGGAGCAGG + Intergenic
1119137340 14:72232808-72232830 GGACCAGAGGGAACAGGTGCTGG + Intronic
1120528783 14:85607957-85607979 GGACCCAAGAGAAGAGAAGATGG - Intronic
1123024506 14:105418460-105418482 GGGCTGCAGGGAACAGGAGCTGG - Intronic
1123143442 14:106105586-106105608 GGAGCCATGGGTGCAGGAGCTGG - Intergenic
1123191546 14:106576583-106576605 GGAGCCATGGGTGCAGGAGCTGG - Intergenic
1124197036 15:27640001-27640023 GGACCCAAGTGAATAGGGTCTGG + Intergenic
1124803258 15:32856045-32856067 TGCACCAAGGGAACAGCAGCTGG + Intronic
1124890430 15:33727079-33727101 GGACCCAGGGGAAAACGAGAAGG - Intronic
1128081190 15:64857903-64857925 GGAGCCAATGGAACAAGAGGAGG - Intronic
1129720144 15:77873429-77873451 GGTCCCAAGGGAAGGGGAGAAGG - Intergenic
1130062036 15:80577254-80577276 GGACCCAAGTGAGCTGGAGCTGG + Intronic
1130446881 15:84010840-84010862 GAAAGCATGGGAACAGGAGCAGG - Intronic
1131074391 15:89486213-89486235 CCACCCCAGGGAACAGGTGCTGG - Intronic
1131153287 15:90060033-90060055 GGACCCAACAGAGCAAGAGCGGG - Intronic
1132062703 15:98705615-98705637 GGACCCAAGGGCTGAGGAGTGGG - Intronic
1132536717 16:485268-485290 GGACCCAACAGACCAGGGGCAGG - Intronic
1132671741 16:1104760-1104782 GGACTCAAGGGGGCAGGAGGAGG + Intergenic
1133878053 16:9753175-9753197 TGACGGAAGGGAAGAGGAGCCGG - Intergenic
1135889148 16:26341673-26341695 AGACCCTGGGGAAGAGGAGCAGG + Intergenic
1138094718 16:54202732-54202754 AGACCAAAGGGAAAAGGAGTGGG - Intergenic
1138190526 16:55010152-55010174 GTAGCCAAGGGTACAGGAGCTGG - Intergenic
1139434499 16:66928252-66928274 GGACACAAGGGTACAGGGGATGG - Intergenic
1140777161 16:78260187-78260209 GGACCCAGGTGAACAGGGTCTGG + Intronic
1140965197 16:79959173-79959195 GGACCTAAGGGACCAGGATTGGG - Intergenic
1141779504 16:86150293-86150315 TCACCTAAGGGGACAGGAGCTGG - Intergenic
1142104013 16:88292322-88292344 TGAGCCAAGGCCACAGGAGCCGG + Intergenic
1142146559 16:88495261-88495283 GGCCACAAGGAAACAGGTGCAGG + Intronic
1142556045 17:778210-778232 AAACCCAAGGAAGCAGGAGCGGG + Intronic
1143108724 17:4542033-4542055 GCACACAAAGGCACAGGAGCAGG - Intronic
1143165298 17:4894445-4894467 GGAGCCTGGGGAACAGCAGCAGG + Intronic
1143303037 17:5925112-5925134 GAACCCAAGGGTGCAGGGGCTGG + Intronic
1143444181 17:6997382-6997404 GGACCACATGGAACAGGAGGGGG + Intronic
1143580305 17:7821759-7821781 GGACAGAGGGGAAGAGGAGCTGG - Intronic
1143714228 17:8755669-8755691 GGAGAGAAGGGAACAGGGGCTGG + Intronic
1144265404 17:13563442-13563464 GGGGCCAAGGGAATTGGAGCAGG + Intronic
1144314948 17:14050759-14050781 GGATCCAAAGGTGCAGGAGCTGG + Intergenic
1144453486 17:15400214-15400236 GGACCCAAGAAAGCAGGAACAGG + Intergenic
1144646315 17:16976378-16976400 GGCCTCAAGGGACCAGGAGTAGG - Intergenic
1144669801 17:17126552-17126574 GGGCACAAAGGAAGAGGAGCTGG + Intronic
1144765703 17:17731323-17731345 GCACCCAAAGGGACAGGGGCTGG + Intronic
1146063418 17:29618570-29618592 GGAGGGGAGGGAACAGGAGCCGG + Intronic
1147142125 17:38465869-38465891 GGACCCCAGGAAACAGATGCTGG + Intronic
1148349242 17:46927997-46928019 GCAACCAAGGGAACAGGTACAGG - Intronic
1148836046 17:50466488-50466510 GGTGCCAGGGGAAGAGGAGCTGG - Intronic
1149237757 17:54612924-54612946 GGATCCTGGGGCACAGGAGCTGG - Intergenic
1150218018 17:63480985-63481007 GGGCCCCAGGGTACAGGTGCCGG + Intergenic
1151344619 17:73494069-73494091 GGGCCCCTGGGAACAGGAGAGGG - Intronic
1152172889 17:78765178-78765200 GGGTCCCAAGGAACAGGAGCAGG + Intronic
1152943792 17:83187116-83187138 TGAGCCCAGGGAACAGGAGCAGG - Intergenic
1153344351 18:4009830-4009852 CGGACCAAGGGAACAGTAGCAGG + Intronic
1153816042 18:8791126-8791148 AGCTCCAAGGGAACAGGAGATGG + Intronic
1155296061 18:24385515-24385537 GGAGGCCAGGGAAGAGGAGCTGG + Intronic
1156706550 18:39889317-39889339 GGAAAGAAGGGAACAGGAGGGGG - Intergenic
1156718560 18:40042097-40042119 GGACCAAAGGGAAAGAGAGCTGG - Intergenic
1156835984 18:41555617-41555639 GATCCCATGGGAACAGCAGCCGG + Intergenic
1157273989 18:46297265-46297287 GGACCCAAGAGAGCAGGCTCAGG + Intergenic
1157684604 18:49632093-49632115 GGACCCATGGCAAGAGGGGCTGG - Intergenic
1157696823 18:49729800-49729822 GGACACTTGGGAACAGGAACAGG - Intergenic
1158732857 18:60044916-60044938 GGACACAGGGGAGCAGCAGCAGG + Intergenic
1161014663 19:1977835-1977857 TGGCCCCAGGGAACAGGACCTGG + Intronic
1162003507 19:7763281-7763303 GGAACCAAGGGTGCAGCAGCTGG + Exonic
1162858744 19:13489705-13489727 AGACCCAAGGGGACAGGTGAAGG - Intronic
1163256244 19:16157640-16157662 TGACCCCAGGGGACAGGAGTTGG + Exonic
1163404240 19:17112583-17112605 GGTCCCAAGGGAGGAGGAGAGGG + Intronic
1165955313 19:39498860-39498882 GGCCCCAAGGGACCAAGGGCGGG - Intergenic
1166283148 19:41808550-41808572 GGACTAAAAGGCACAGGAGCAGG + Intronic
1167603001 19:50465338-50465360 GGAGCCCAGGGTAAAGGAGCGGG - Intronic
1167909368 19:52689756-52689778 GGGCCAAAGGGATCAGGAGACGG - Intronic
1167999438 19:53432660-53432682 GGGCCAAAGGGATCAGGAGACGG + Intronic
1168152513 19:54456518-54456540 GGACCCATGGGAGAAGGAGGAGG + Intronic
1168277544 19:55285834-55285856 AGACCCTAGGGAAAAGGAGAGGG + Intronic
1168703381 19:58454519-58454541 AGCTCCAAGGGCACAGGAGCTGG + Intronic
1168705882 19:58470017-58470039 AGCTCCAAGGGCACAGGAGCGGG + Intronic
925901405 2:8511782-8511804 GGGCCCAGGGGAAAAGGAGGTGG - Intergenic
926092488 2:10059877-10059899 GGAACCCAGGCAGCAGGAGCAGG - Intronic
926789019 2:16551216-16551238 GGATCCAAGGGAAGATCAGCTGG + Exonic
927241043 2:20919677-20919699 GAACCCAATTGAACTGGAGCTGG - Intergenic
928772609 2:34720061-34720083 GGATCCAATGGGAGAGGAGCAGG - Intergenic
928910717 2:36418085-36418107 GGGACTAAGGGAACAGGTGCAGG + Intronic
928915092 2:36462027-36462049 GGAAACAAGGAGACAGGAGCTGG + Intronic
931823152 2:65972745-65972767 GGACTTAAGGGAATAGGACCCGG - Intergenic
934299441 2:91768487-91768509 GGACCCCAGGCAACGGAAGCAGG - Intergenic
936071624 2:109375219-109375241 GGAGCCATGGGAAGAAGAGCTGG - Intronic
936144453 2:109970511-109970533 GGACACAAGGCAAAAGGGGCAGG - Intergenic
936144780 2:109973336-109973358 AGACCCAAGAGAACATAAGCAGG - Intergenic
936181137 2:110268471-110268493 GGACACAAGGCAAAAGGGGCAGG - Intergenic
936181466 2:110271299-110271321 AGACCCAAGAGAACATAAGCAGG - Intergenic
936199906 2:110398133-110398155 AGACCCAAGAGAACATAAGCAGG + Intergenic
936200234 2:110400958-110400980 GGACACAAGGCAAAAGGGGCAGG + Intergenic
936375765 2:111940062-111940084 GGGCTCTAGGAAACAGGAGCTGG - Intronic
936496424 2:113025903-113025925 TGACCCTAGGGAACATGAGAAGG + Intronic
937734149 2:125269614-125269636 GGACAAAAGGGAGGAGGAGCAGG - Intergenic
941494923 2:166188064-166188086 GGTCCCAAGGAGACAGAAGCAGG + Intergenic
945627052 2:212222637-212222659 GGACCCAAAGGAGCAAGAGTGGG - Intronic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
947457157 2:230265537-230265559 GGACCCAATGGGAGAGGAGCAGG - Intronic
948752623 2:240141306-240141328 GGACCCCAAGGAGCAGGACCAGG - Intronic
948809766 2:240468558-240468580 GACCCCACAGGAACAGGAGCGGG - Intergenic
1169314886 20:4582233-4582255 TGATCCCAGGGAACAGGAGGTGG - Intergenic
1170388843 20:15850460-15850482 AGACCCACGGGAACATGAACAGG + Intronic
1171371467 20:24665081-24665103 GGCCCCAAGGGAATAAGAGAAGG - Intronic
1172637601 20:36420496-36420518 AGACCCAAGGGAAGAGGGGCAGG + Intronic
1172786034 20:37469509-37469531 GGTCCCAGGAGAACAGGAGAAGG - Intergenic
1173615492 20:44400659-44400681 GGATCACAGGGAGCAGGAGCGGG + Intronic
1174647181 20:52096243-52096265 TGACCTAGGGGAACATGAGCGGG - Intronic
1174992049 20:55522318-55522340 GGACCCAGGTGAATAGGATCTGG - Intergenic
1175170459 20:57076711-57076733 GGACCCAAAGGAGCTGGAACAGG - Intergenic
1175582352 20:60110532-60110554 GGATCACAGAGAACAGGAGCGGG - Intergenic
1175732793 20:61365466-61365488 GGAGCAAAGGGGACAGGAGGCGG + Intronic
1175777486 20:61662507-61662529 GGACTGAAAGGGACAGGAGCTGG + Intronic
1178189055 21:30259314-30259336 TGACCCAAGGGAACTGAATCAGG - Intergenic
1179433497 21:41343166-41343188 TGAGCCAAGGGAACAGAAGTTGG - Intronic
1181697795 22:24602589-24602611 GGACCCCAGGCAACGGAAGCAGG - Intronic
1182705959 22:32280510-32280532 GGACACAAGGCCACAGGAGAGGG - Intergenic
1183579110 22:38712750-38712772 GGACCTGAAAGAACAGGAGCAGG + Intronic
1184120131 22:42444642-42444664 GGACCCAGGCCATCAGGAGCGGG - Intergenic
1184288517 22:43485948-43485970 GGCCCCAAGGGCAGTGGAGCTGG + Intronic
1184394282 22:44223593-44223615 GGACGCAAGGCCACAGGAGAGGG - Intergenic
1184792462 22:46708529-46708551 GGACCCAAGGCAAGAGCAGAGGG + Intronic
949217261 3:1584253-1584275 GGACCTAAGGTAACATGAGCAGG + Intergenic
949370916 3:3333892-3333914 GGATCCAAGGGAACCAAAGCTGG + Intergenic
949831941 3:8224110-8224132 GGGCCTAAGGGGACAGGAGTGGG - Intergenic
950141289 3:10617831-10617853 TGCCCCAAGGGAGCACGAGCTGG + Intronic
950780489 3:15387479-15387501 GAACCAAAGTGAATAGGAGCTGG - Intronic
951063161 3:18234137-18234159 GGACACAAGGTAGTAGGAGCTGG + Intronic
951281710 3:20758357-20758379 AGACCCAAGGGAACAAATGCAGG + Intergenic
952905030 3:38134205-38134227 GGACCCTCAGGGACAGGAGCTGG - Intronic
953289754 3:41649493-41649515 GGAGGCCAGGGAGCAGGAGCAGG - Intronic
954610407 3:51941989-51942011 GGACCCAATGGAGCAGTAGGAGG - Intergenic
955356854 3:58238442-58238464 GGGCGCAAGGGCACGGGAGCCGG - Intronic
956437042 3:69244270-69244292 GGAGACAATGGAAGAGGAGCTGG + Intronic
956521025 3:70104560-70104582 ACCCCCAAGGGAAAAGGAGCTGG + Intergenic
956621995 3:71230463-71230485 GGAAACAAAGGAACAGGAGGGGG + Intronic
956969205 3:74502593-74502615 GGACCTCAGAGATCAGGAGCTGG - Intronic
957417782 3:79929064-79929086 AGAGGCCAGGGAACAGGAGCAGG - Intergenic
957646589 3:82939030-82939052 AGAGCCCAGGGAGCAGGAGCAGG - Intergenic
958678328 3:97294048-97294070 GGAGGCCAGGGAGCAGGAGCTGG + Intronic
958999618 3:100947834-100947856 AGACCCAAGGGAACACTAGAGGG + Intronic
960395204 3:117129359-117129381 GGAACCAAGAAAACAAGAGCAGG - Intronic
961413958 3:126744013-126744035 TGACCCGAAGGAAGAGGAGCAGG - Intronic
961825354 3:129596461-129596483 GGACCCAGGGGGAGGGGAGCTGG - Intronic
962812547 3:138972041-138972063 GGAGCCATGGGAACAGGGGAGGG + Intergenic
963939592 3:151085956-151085978 GGGCGGAAGGGAAGAGGAGCTGG + Intronic
966124235 3:176556788-176556810 GCTCCCAAGGGAACAGGAGGTGG - Intergenic
967529419 3:190531863-190531885 GGACTTAGGGGAACAGGAGGAGG + Intronic
969600157 4:8171403-8171425 GGGCCCAGGGCAACAGGAGTGGG - Intergenic
971146334 4:23980677-23980699 GGACCCAAGGCATTTGGAGCCGG + Intergenic
975207436 4:71661626-71661648 GGACCTAAGGAAAAAGGGGCTGG + Intergenic
976374220 4:84325714-84325736 GGACCTTATGAAACAGGAGCAGG + Intergenic
978670615 4:111244022-111244044 GGATCCAAAGGGAGAGGAGCAGG + Intergenic
979742492 4:124168353-124168375 GGACCCAGGAGAACAGGGTCTGG + Intergenic
981271415 4:142850560-142850582 GGACTCATTGGAGCAGGAGCTGG - Intergenic
981318297 4:143363417-143363439 GGACCTAATGAAACATGAGCTGG + Intronic
981346555 4:143683566-143683588 GGATCCAACGGGAGAGGAGCAGG + Intronic
982507899 4:156242547-156242569 TCACCCAAGGGTACAGCAGCTGG + Intergenic
983621582 4:169767115-169767137 ATAGCCAAGGAAACAGGAGCTGG + Intergenic
985912745 5:2896307-2896329 GGAGCCATGGGCAGAGGAGCAGG + Intergenic
986129233 5:4911696-4911718 GGCTCCAAGGGAACAGAATCAGG - Intergenic
986155399 5:5169788-5169810 GAACCCGAGGGCACATGAGCAGG - Intronic
986164241 5:5259626-5259648 GGTTGCAAGGGAAAAGGAGCAGG + Intronic
987083292 5:14445769-14445791 TGGCCCAAGGGCACAGAAGCAGG + Intronic
988034590 5:25809820-25809842 TGACACAAGGGAGCAGAAGCAGG + Intergenic
988916271 5:35896516-35896538 GGTCACAAGGGAACTGTAGCTGG - Intergenic
989305534 5:39951056-39951078 GGACCCAGGAGAATAGGATCTGG + Intergenic
989992263 5:50781562-50781584 GGACCCAGGGGAACAGGGTAGGG - Intronic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
991456829 5:66812811-66812833 GAACGGAAGGGAGCAGGAGCAGG - Intronic
991957262 5:72007687-72007709 GGATCCATGTAAACAGGAGCTGG + Intergenic
995186811 5:109280739-109280761 GTAACCATGGGCACAGGAGCTGG + Intergenic
997433291 5:133856435-133856457 GGACCCCAGGGCACAGTGGCAGG - Intergenic
997699721 5:135888472-135888494 GGATCCACGGGTGCAGGAGCGGG - Exonic
997820429 5:137061304-137061326 GGATAAAAGGGAACAGGAGGCGG - Intronic
998402606 5:141855800-141855822 ACACCCACGGGAACAGGAGTTGG + Intronic
998940766 5:147280155-147280177 GGATCCAATGGGAGAGGAGCGGG + Intronic
999189959 5:149739851-149739873 GGAGCCAAGGGGTCAGCAGCTGG + Intronic
1002637216 5:180614390-180614412 AGACCCAGGAGAACAGCAGCAGG - Intronic
1002901214 6:1411022-1411044 GTTCCCAAAGGAACAGGAGAGGG + Intergenic
1004036767 6:11931901-11931923 GGGCCCAAGCATACAGGAGCCGG + Intergenic
1005947652 6:30606074-30606096 GGACACAAGGGAGCAGGAGGGGG - Intronic
1006199142 6:32270745-32270767 AGGCCCAAGGGAAGAGGGGCTGG - Intergenic
1006333023 6:33405636-33405658 GGACCCATGGGCACTGGAACTGG + Intronic
1007382929 6:41502412-41502434 GGATCAGAGTGAACAGGAGCGGG + Intergenic
1007412671 6:41673972-41673994 GGCCCCCAGGGAACAGGAGCAGG + Intergenic
1007930727 6:45688054-45688076 AGACCCAAGAGAAGAGGGGCCGG - Intergenic
1008407832 6:51138885-51138907 GGACCAAGAGGAACAGGAGTGGG - Intergenic
1009051400 6:58280933-58280955 AGATCCAAAGGAACAGCAGCCGG + Intergenic
1009707041 6:67265865-67265887 GGACCCAGGCGAACAGAATCTGG - Intergenic
1010047147 6:71458535-71458557 GGACCCAGAAGAACAGCAGCTGG - Intergenic
1010561922 6:77361562-77361584 TGACCAAAGGGAAATGGAGCTGG - Intergenic
1011377549 6:86706407-86706429 GGACCCAGGGGAATAGGGTCTGG - Intergenic
1011640859 6:89414489-89414511 GGACTCAAGGGATCAGGAAAGGG + Intergenic
1012112791 6:95258989-95259011 GCACACAAGTGGACAGGAGCAGG + Intergenic
1017687560 6:156928443-156928465 GGGCCCAAGGGAGAAGGAACAGG + Intronic
1018163389 6:161069841-161069863 GGACCAAAGGGAGGAGAAGCAGG + Intronic
1019545568 7:1573431-1573453 GTACCCAAGGGTAAAGGAACTGG + Intergenic
1021590077 7:22251480-22251502 GGAACCAAGGACAAAGGAGCTGG + Intronic
1021598378 7:22340716-22340738 GGACCAGAGGGAAGAGGAGAGGG - Intronic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1023488804 7:40715367-40715389 GGATGCCAGGGAACAGGAGATGG - Intronic
1023715776 7:43042789-43042811 GGACACAAGGGGACAAGAGAAGG + Intergenic
1023841493 7:44101024-44101046 GGACCAAAGGGGAAAGGACCAGG - Intergenic
1024887364 7:54159901-54159923 TGACCCATGGGAACAAGAGGAGG + Intergenic
1026045947 7:66905342-66905364 GGCCGCAAGGAGACAGGAGCCGG - Intergenic
1027051797 7:75025444-75025466 AGAGCCGAGGGGACAGGAGCTGG - Intergenic
1028748628 7:94356493-94356515 GGAACCAAGGGAAATGAAGCAGG + Intergenic
1029551373 7:101238852-101238874 GAGCCCTAGGGAACCGGAGCAGG - Intergenic
1029599050 7:101553248-101553270 GGCCCCCAGGGAACTGGAGAGGG + Intronic
1030319937 7:108155561-108155583 GGTACCAAGGGAACAGAAGCAGG - Intronic
1034201904 7:149287907-149287929 GGCCCCCAAGGTACAGGAGCTGG + Intronic
1035677922 8:1468103-1468125 GGACCCAGGGTCACAGGAGCAGG + Intergenic
1035906026 8:3511183-3511205 GGACACAAGGGCACAGGAAGGGG + Intronic
1037829081 8:22177621-22177643 GGACTCAAGGGAACATGGGAAGG - Intronic
1037875898 8:22548239-22548261 CCACTCATGGGAACAGGAGCAGG - Intronic
1038545466 8:28422890-28422912 GGACCCTAGAGAACTGGGGCTGG - Intronic
1039597152 8:38800199-38800221 AGACCCGAGGGAAATGGAGCAGG - Intronic
1041319471 8:56598620-56598642 GCACCCAAGGAAACTGAAGCAGG + Intergenic
1042556691 8:70039347-70039369 GTACCCCAGGAACCAGGAGCGGG + Intergenic
1043083314 8:75794294-75794316 GGGGGCAAGGGAACATGAGCAGG + Intergenic
1043401545 8:79890111-79890133 GGACCCCAGGTTACAGGAGTGGG + Intergenic
1045876687 8:106990050-106990072 GGGCCCGAGAGAACAGGAGAAGG + Intergenic
1047348828 8:124054091-124054113 GAACCCATGGGAACAGGGGATGG - Intronic
1048203400 8:132395865-132395887 GAACCCATGGGAACACGAACTGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1051352196 9:16207481-16207503 AGACCCAAGAGAACTTGAGCTGG + Intronic
1051459015 9:17293057-17293079 GGACCCAAGTGAATAGGGTCTGG - Intronic
1052996842 9:34555723-34555745 GGGCCCAAGGGGTCAGGATCAGG - Intronic
1053415782 9:37946002-37946024 TGACCCCAGGAAACAGGGGCAGG + Intronic
1056768528 9:89460180-89460202 GGACCCAAGGGGCCTGGAGAAGG - Intronic
1057417557 9:94878359-94878381 GGACCCAAGGTTACAGGTGTGGG + Intronic
1057810803 9:98255488-98255510 GGACCCAGGGGCAGAGGAGCTGG + Exonic
1058553309 9:106138854-106138876 GGACTCAAGGGAACATGGGTGGG + Intergenic
1059335524 9:113566301-113566323 GGAGCCAAGGGAGCAGGTGCAGG - Intronic
1059653681 9:116337884-116337906 AGACCCAAGAAAACAGGATCAGG + Intronic
1059799808 9:117738812-117738834 GGACTCCAGAGAACAGGTGCAGG - Intergenic
1060177614 9:121508557-121508579 GCACCCTAGTGAACAGGTGCTGG - Intergenic
1061065730 9:128276384-128276406 GGACCCCAGGGCTCAGGAGGTGG + Exonic
1061260006 9:129474996-129475018 GGTGCTCAGGGAACAGGAGCTGG - Intergenic
1061475304 9:130861602-130861624 GGAGAAAAGGGAACAGGATCAGG - Intronic
1061586122 9:131569929-131569951 GGACCCAAGGGTACAACAGCTGG - Intergenic
1062025102 9:134336586-134336608 GGCCCCACGGGAAGAGGAGCAGG - Intronic
1062185587 9:135216501-135216523 GGCCCCAAGGGAAGGGAAGCTGG - Intergenic
1062291773 9:135798520-135798542 GGCCCCCAGGGGACAGGAGGAGG - Intergenic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1185432067 X:17276-17298 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1185441383 X:229990-230012 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1185774464 X:2791428-2791450 AGACCCAAGGGAAAAGGCACTGG - Intronic
1189061136 X:37754748-37754770 GGAAGCCAGGGAACAGGAGGTGG - Intronic
1190862897 X:54360257-54360279 AGAGACAAGGGAAGAGGAGCAGG - Intergenic
1191223635 X:58017007-58017029 GGTTCCCAGGGAATAGGAGCTGG - Intergenic
1192798724 X:74446127-74446149 GGTCCCAGGGGAAGAGGAGGGGG - Intronic
1193984107 X:88219478-88219500 GGTCCAAATGGAACAGCAGCCGG - Intergenic
1196168051 X:112556252-112556274 GGACCCAGGTGAACAGGGTCTGG + Intergenic
1197671734 X:129284821-129284843 GGACCCAACAGGAGAGGAGCAGG - Intergenic
1198517887 X:137427332-137427354 GGAAGCGAGGGAACAGGATCCGG - Intergenic
1200090882 X:153635420-153635442 GGACCCAAGCAAGCAGGGGCAGG + Intergenic