ID: 1067962888

View in Genome Browser
Species Human (GRCh38)
Location 10:50876336-50876358
Sequence TGTCCAAGTGGAGCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067962888_1067962891 2 Left 1067962888 10:50876336-50876358 CCAGCCTGTGCTCCACTTGGACA 0: 1
1: 0
2: 1
3: 13
4: 230
Right 1067962891 10:50876361-50876383 CTTATCAGAAACTCAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067962888 Original CRISPR TGTCCAAGTGGAGCACAGGC TGG (reversed) Intronic
900154610 1:1198931-1198953 TGTCCCTGTGGAGCGCAGGGTGG - Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900412998 1:2521509-2521531 TCTCCCGGGGGAGCACAGGCGGG + Intronic
904342830 1:29848687-29848709 AGTCTACTTGGAGCACAGGCTGG + Intergenic
904428145 1:30444912-30444934 CGTGCAAGTGGAGCACATGCAGG - Intergenic
905327932 1:37171140-37171162 TGTCCAAATAAACCACAGGCAGG + Intergenic
905951230 1:41953016-41953038 TGTCAAAGTTGGGGACAGGCAGG - Intronic
906210045 1:44007715-44007737 TGTCCCAGATGAGCAGAGGCTGG - Intronic
906417035 1:45628337-45628359 TCTCCAAGGGGAGAACAGACTGG + Exonic
907399013 1:54213054-54213076 GGCAGAAGTGGAGCACAGGCAGG + Intronic
908412025 1:63876364-63876386 TGTGCAAGTGATGCACAGGGTGG - Intronic
909777177 1:79495967-79495989 TTTGAAAGTGGAGCTCAGGCAGG - Intergenic
910860085 1:91734547-91734569 TGGCCAAGTGAAACACAGGGAGG - Intronic
913136412 1:115893826-115893848 TGTAAAAGTGTTGCACAGGCTGG + Intergenic
920316366 1:205078202-205078224 GGTCCAAGCAGAGCACAGGCAGG + Exonic
920319569 1:205108566-205108588 TGTCCAAGTAGCCCACAGGAAGG + Intronic
920381857 1:205539367-205539389 TTACCAAGTGGAACACTGGCTGG - Intergenic
920397926 1:205660106-205660128 TGTCGGAGTGGAGGGCAGGCAGG - Intronic
920838770 1:209536293-209536315 TGTCCAAGGGCAGCAGAGGTAGG - Intergenic
921253381 1:213317999-213318021 TGGGCAAGAGGAGCCCAGGCTGG - Intergenic
921685090 1:218080931-218080953 TGTGCAAGTGAACCAGAGGCGGG + Intergenic
923328980 1:232905224-232905246 GGTCCACCTGGAGCATAGGCTGG - Intergenic
1062902965 10:1159484-1159506 TCTTCAACAGGAGCACAGGCAGG + Intergenic
1066253262 10:33654445-33654467 TCTCCAACTGTAGCCCAGGCTGG - Intergenic
1067564364 10:47326086-47326108 TGAGCCAGAGGAGCACAGGCGGG + Exonic
1067962888 10:50876336-50876358 TGTCCAAGTGGAGCACAGGCTGG - Intronic
1068121447 10:52785561-52785583 TGACCAAGCTGAGCACATGCTGG - Intergenic
1073518539 10:104102141-104102163 TGGCCAAGTGGAGGAGAGGGAGG - Intergenic
1076132432 10:128022530-128022552 TGACCAGGAGGAGCACAGGGAGG - Intronic
1076161872 10:128250488-128250510 TATCCAATAGGAGCACAGGGAGG - Intergenic
1077440912 11:2568664-2568686 TGTCCATGTTGAGCACTGACTGG + Intronic
1081456233 11:43225759-43225781 AGCACAAGAGGAGCACAGGCAGG - Intergenic
1081908104 11:46681970-46681992 TGCCCAAGTGGAGGGCAGCCCGG + Intronic
1084053835 11:66618170-66618192 TTCCCAAGTGGAGCAGAGACTGG - Intronic
1084164332 11:67367986-67368008 GGTACAACTGGAACACAGGCAGG - Intronic
1084653642 11:70502892-70502914 TGTCAAAGTCGGCCACAGGCAGG - Exonic
1089090820 11:115873370-115873392 TCTCCAACTGGAGCTCAGCCAGG - Intergenic
1090658480 11:128863265-128863287 TGTGCAACTGGAGCAGAGGGAGG + Intronic
1090834790 11:130446531-130446553 TGTCCAAGGAGAGAAAAGGCTGG - Intergenic
1092088291 12:5783840-5783862 TGCGGAAGTGGGGCACAGGCTGG - Intronic
1092551618 12:9508391-9508413 TGTCCAAGTGTAGTACAGGCTGG + Intergenic
1093574599 12:20712381-20712403 CGGCCAAGTGAAGCCCAGGCAGG - Intronic
1095521907 12:43076509-43076531 TGTCCACCTGGAGTGCAGGCTGG - Intergenic
1095941097 12:47727392-47727414 TGTCAGAGTGGAGTACAGCCTGG + Intergenic
1096057869 12:48669902-48669924 TATACAAGTCTAGCACAGGCTGG + Intronic
1098141238 12:67452146-67452168 TGTCCAGCTGGAAGACAGGCAGG - Intergenic
1098302356 12:69067175-69067197 TGGGCAAGTGAAACACAGGCTGG + Intergenic
1100674085 12:96847342-96847364 TGCACAAGTAGAGCACAGGGAGG - Intronic
1102874789 12:116441214-116441236 TCTCCATGTTGAGCCCAGGCTGG + Intergenic
1102927760 12:116839623-116839645 TGTCCAAGTGGAGGAGTGGATGG + Intronic
1108061319 13:46536450-46536472 TGTCCTATTGGAGCTAAGGCTGG - Intergenic
1110860294 13:80340048-80340070 TGTCCACACGGAGCAGAGGCGGG + Intronic
1113225433 13:108154171-108154193 TGTCCATATGTAGCACAGGTAGG - Intergenic
1113722325 13:112568598-112568620 TGTCCAAGTGGAGTAGATGTTGG - Intronic
1115874536 14:37845500-37845522 TGTCAGAGTGGAGCACATACGGG - Intronic
1117437436 14:55730145-55730167 TGGCAAAATGGGGCACAGGCAGG + Intergenic
1118790889 14:69091736-69091758 TGTCAAACTGAAACACAGGCAGG + Exonic
1119289298 14:73482087-73482109 TGAATAAGTGAAGCACAGGCCGG + Intronic
1120157422 14:81109111-81109133 TGCCAAAGTGGATCACAGGCCGG + Intronic
1121067848 14:90985446-90985468 TGTCCAAGTTGAGCACAACAAGG - Intronic
1121868571 14:97385929-97385951 TGGCCAAGGGGAGCAAAGGAAGG + Intergenic
1122608523 14:102964530-102964552 TGTCCAGGAGGAGCTCAGGAAGG - Exonic
1123203231 14:106687092-106687114 TGTGCAAGAGGAGCACATGAGGG - Intergenic
1126433128 15:48608065-48608087 TGTCCAAGAGAATCACTGGCTGG + Intronic
1127269784 15:57390193-57390215 TGGCCAAGTGAAGCACAGCCTGG - Intronic
1127972829 15:63975137-63975159 AGCCCCAGTGGAGCACATGCTGG - Intronic
1129266156 15:74394310-74394332 TGTGGAACTGGAGCACAGGAAGG - Intergenic
1129533475 15:76290372-76290394 TGTCACCCTGGAGCACAGGCTGG + Intronic
1129724993 15:77897165-77897187 TGGCCAAGGGGGGCACAGCCTGG + Intergenic
1130867949 15:87948179-87948201 TGTCCAGGTGGAGAACTGACTGG - Intronic
1131742006 15:95403092-95403114 TGTCCAAGGGGAGCAGAAGAAGG - Intergenic
1133546241 16:6810363-6810385 TGTCCAAGTGGTGAAGAGGTAGG + Intronic
1134273411 16:12754701-12754723 TGTTAAAGTGTAGCATAGGCAGG + Intronic
1137508310 16:49076049-49076071 TGCCCAGGTGAAGCACAGGGAGG - Intergenic
1137730690 16:50687438-50687460 TGGCCAACAGGAGAACAGGCAGG + Intergenic
1140150422 16:72358010-72358032 TGACTCAGTAGAGCACAGGCAGG + Intergenic
1140469835 16:75207811-75207833 TGACCAAGTAGAGGAGAGGCTGG + Intergenic
1140895131 16:79317850-79317872 TCTCCAAATGGAGCAGGGGCTGG - Intergenic
1140918527 16:79515697-79515719 TGCCCAAGTGTAGCAAGGGCAGG - Intergenic
1141813002 16:86388745-86388767 GGTCTCAGTGGAGCACTGGCTGG - Intergenic
1141815720 16:86408170-86408192 TGGCCAACGGGAGCACAGGCAGG - Intergenic
1143284330 17:5777859-5777881 TATCCAAGAGGAGCAAAAGCAGG + Intronic
1144703194 17:17351708-17351730 TGCCCAAGTGCAGCAGAGACCGG - Intergenic
1145965936 17:28917302-28917324 TGACCGACTGGAGCACACGCCGG + Exonic
1146532820 17:33624466-33624488 TGTCCAAGTGCAGTACCAGCTGG - Intronic
1148851358 17:50557025-50557047 TGGACAAGTGGAGCCCAGCCTGG + Intergenic
1148914111 17:50960182-50960204 TGCCCAAGAGGAACTCAGGCTGG - Intergenic
1150216865 17:63476111-63476133 TGTCCTATTGGCGCACAGGGCGG - Intergenic
1150251127 17:63705051-63705073 TGCCCAAGGGGAGGCCAGGCTGG + Intronic
1151038929 17:70835450-70835472 TGGCCAAGTGCAGCATAGGTAGG - Intergenic
1151990389 17:77570678-77570700 TGTCCAGGCTGAGCTCAGGCTGG - Intergenic
1152423222 17:80205117-80205139 TGGGCACGAGGAGCACAGGCCGG - Exonic
1152544995 17:80995919-80995941 TGACCGGGTGCAGCACAGGCTGG + Intronic
1153794639 18:8610268-8610290 GGTTCGAGTGGAGCGCAGGCAGG + Intronic
1154121855 18:11658610-11658632 TGTCCCAGAGGAGGACTGGCTGG - Intergenic
1155702237 18:28760950-28760972 TGGCCAAGTAGATCAAAGGCAGG + Intergenic
1156858578 18:41811579-41811601 TATCTATGTGGAGCAGAGGCTGG + Intergenic
1159706470 18:71695651-71695673 TGTTCAAGTGGAGCACACAGGGG - Intergenic
1160492852 18:79352317-79352339 TGGGCAGGAGGAGCACAGGCAGG + Intronic
1161067809 19:2247204-2247226 TGGCCCAGTGGAGCCCAAGCAGG - Intronic
1161162688 19:2769767-2769789 TGTCCGAGGGGGGCACAGGAGGG - Intronic
1161162780 19:2770006-2770028 TGTCCGAGGGGGGCACAGGCGGG - Intronic
1161162789 19:2770029-2770051 TGTCCGAGGGGGGCACAGGCGGG - Intronic
1163212639 19:15852447-15852469 TTTCCAAGTGGAGCTCAGATAGG + Intergenic
1163394110 19:17049088-17049110 AGTCCCAGTGGAGCACAGATGGG + Intergenic
1163627453 19:18398281-18398303 GGTCCATGTGGAGCCAAGGCAGG + Intergenic
1164758451 19:30708521-30708543 TGTCCCTGGGGAGGACAGGCTGG + Intronic
1165655506 19:37528958-37528980 TGTCCACGTGGTCCCCAGGCAGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166745997 19:45142153-45142175 TCTCCAAGTGCAGCACTGCCAGG - Exonic
927812930 2:26190200-26190222 AGTACAACTGGAGCAGAGGCAGG + Intergenic
928879887 2:36086432-36086454 TGTCCATGTGGAGGAGAGGAAGG + Intergenic
929457543 2:42076587-42076609 TGTCCATGTGGGGCTCAGCCGGG - Intergenic
929957306 2:46468086-46468108 TGTTCAAGTTGAGGACAGACAGG - Intronic
931800021 2:65749084-65749106 TGTGCATGTGGAGCACAGGAGGG + Intergenic
933185561 2:79275260-79275282 TGTCCAAGAGGATCAAAGGTAGG + Intronic
933193755 2:79366322-79366344 CATACAAGTGGAACACAGGCCGG + Intronic
933987831 2:87607292-87607314 TGTCCAAGTAAACCACAGGAAGG + Intergenic
934334134 2:92107966-92107988 TGTCCATTTGGAGCACATTCCGG + Intergenic
934334463 2:92112734-92112756 TGTCCATTTGGAGCACATTCCGG + Intergenic
934513244 2:94965367-94965389 TGTCCATGTGGATCACAGTAGGG + Intergenic
936306010 2:111343516-111343538 TGTCCAAGTAAACCACAGGAAGG - Intergenic
937956723 2:127425989-127426011 TGGCAAAGTGGCCCACAGGCTGG + Intronic
938291529 2:130153284-130153306 TGTCTCAGAGGCGCACAGGCTGG - Intronic
939755712 2:146106838-146106860 TGTCCACCTGGAGTGCAGGCTGG + Intergenic
939853370 2:147326691-147326713 TGTGGAAGTGGATCACAGGAAGG - Intergenic
941011194 2:160301625-160301647 TTAACAAGTGGAGCACATGCTGG + Intronic
943222517 2:185128524-185128546 TGTGCAAGTGGGGCACATGTGGG - Intergenic
944643842 2:201757563-201757585 TGTGAAACTGGAGCTCAGGCAGG - Exonic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947126997 2:226879992-226880014 TGGTCAAGTTGAGCACAGGTTGG + Intronic
947674003 2:231961392-231961414 TGGCCCAGTGGAGCAGAGCCTGG + Intronic
947806696 2:232973621-232973643 AGACCACGTGGAGCAGAGGCAGG + Intronic
948871155 2:240798925-240798947 CATCCAAGTAGAGCAAAGGCTGG + Intronic
949010629 2:241676372-241676394 TGTCCCTGTGTAGCCCAGGCTGG - Intronic
1170567596 20:17615756-17615778 CGGGCAGGTGGAGCACAGGCTGG - Intronic
1171591023 20:26602380-26602402 TGTCCATTTGGAGCACATTCAGG - Intergenic
1171682457 20:27973098-27973120 TGTCCATTTGGAGCACATTCCGG + Intergenic
1171712093 20:28418719-28418741 TGTCCATTTGGAGCACATTCCGG + Intergenic
1172182763 20:33013701-33013723 GGGCCAAGTGGAGGGCAGGCAGG + Intronic
1172605280 20:36209736-36209758 TGTCCCGGTCGAGCTCAGGCAGG - Exonic
1173841399 20:46159538-46159560 TGTCCAGCTGGGGCACAGGGAGG + Intergenic
1174209521 20:48866460-48866482 TGTCCAGGTGAGCCACAGGCAGG + Intergenic
1174290347 20:49504061-49504083 TCTCCATCTGGAGAACAGGCAGG + Exonic
1175147369 20:56907120-56907142 TGTCCCAGTTGAGGACAGCCTGG - Intergenic
1175976947 20:62715638-62715660 AGTCCAAGTGCAGGACAGCCCGG - Intronic
1176090215 20:63315287-63315309 TATACAGATGGAGCACAGGCTGG + Intronic
1181182906 22:21079696-21079718 GGCCCAAGTGGGGTACAGGCAGG + Intergenic
1181720528 22:24770974-24770996 TGTCCCCCTGGAGCACAGGTGGG - Intronic
1182294666 22:29306095-29306117 TGCCCAACTGGGGCACAGTCAGG - Intergenic
1182450656 22:30418644-30418666 TTCCCAAGAGGAGCAGAGGCAGG + Intronic
1182810572 22:33112723-33112745 TGTCCAAATGGTGAACAGGTGGG + Intergenic
1183000232 22:34850841-34850863 AGTCCACCTGGAGCACAGGCTGG + Intergenic
1183692440 22:39398342-39398364 TGACCAAGTGGGCCCCAGGCAGG - Intergenic
1184273754 22:43399025-43399047 TGTCCTGGAGGAGCCCAGGCCGG + Intergenic
1185090866 22:48772396-48772418 TGTCCCAGAGGAACGCAGGCAGG + Intronic
1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG + Intronic
1185126031 22:49011297-49011319 TGCCACGGTGGAGCACAGGCAGG + Intergenic
1202715970 2_KI270715v1_random:2321-2343 TGTCCATTTGGAGCACATTCCGG + Intergenic
1202716299 2_KI270715v1_random:7089-7111 TGTCCATTTGGAGCACATTCCGG + Intergenic
1202716677 2_KI270715v1_random:12541-12563 TGTCCATTTGGAGCACATTCCGG + Intergenic
1202728663 2_KI270716v1_random:36280-36302 TGTCCATTTGGAGCACATTCCGG + Intergenic
1202728992 2_KI270716v1_random:41048-41070 TGTCCATTTGGAGCACATTCCGG + Intergenic
952675529 3:36025968-36025990 TGTCAATGAGGAGCACAGGTAGG + Intergenic
952776507 3:37051775-37051797 AGCCCAGGTGGGGCACAGGCTGG + Intergenic
953142608 3:40243267-40243289 TTTCAAGGTGGAGCAAAGGCAGG - Intronic
955410766 3:58654034-58654056 GGGCTAAGTGGAGCCCAGGCAGG - Intronic
955547413 3:60045910-60045932 TGTCCATCTGGAGCCCAGGAAGG + Intronic
959502721 3:107125003-107125025 GGGCCATCTGGAGCACAGGCTGG + Intergenic
960342209 3:116487231-116487253 TGTCCATGAGGACCAGAGGCTGG + Intronic
960665272 3:120102946-120102968 TGACCAACTGGAACACTGGCTGG - Intergenic
960785773 3:121371820-121371842 TGCACAGGTGGGGCACAGGCAGG + Intronic
961412329 3:126731380-126731402 GGCCCCAGTGGAGCACAGGGTGG + Intronic
964730520 3:159860050-159860072 TGGCCAAGTGGAGACCAGGGAGG - Intronic
969402743 4:6967806-6967828 TGTCCCAGAGTAGCACAGGAAGG - Intronic
969620623 4:8277075-8277097 TGTTCATGTGGAACGCAGGCGGG - Intronic
970542253 4:17091980-17092002 TTTCAAAGTAGAGCACAGCCTGG + Intergenic
974736143 4:65935620-65935642 TGTGCTAGAGCAGCACAGGCTGG - Intergenic
977909693 4:102518813-102518835 AGACCATGTGGAGCACAGACAGG - Intronic
977936645 4:102813579-102813601 TATACAAGTTGAGAACAGGCTGG + Intronic
981627599 4:146776822-146776844 TGTGGCAGTGGGGCACAGGCCGG + Intronic
986646562 5:9921807-9921829 GGTCAAAGGGGAGCAAAGGCAGG - Intergenic
986846594 5:11763494-11763516 TGGTCAATTGAAGCACAGGCAGG - Intronic
987788975 5:22538937-22538959 TGTGCCAGTGGAACACAGCCTGG - Intronic
988789065 5:34590661-34590683 AGTGCAAGTGGAGTGCAGGCTGG + Intergenic
989267909 5:39499029-39499051 TGTAAGAGTAGAGCACAGGCAGG + Intergenic
992359779 5:76025247-76025269 TGTCCCACTGGAGCATAGGCAGG + Intergenic
992911290 5:81398427-81398449 TCTCACAGTGGCGCACAGGCTGG + Intergenic
993164670 5:84337074-84337096 TGTGTTGGTGGAGCACAGGCTGG - Intronic
996973996 5:129408602-129408624 TCTCCATGTAGGGCACAGGCTGG - Intergenic
997674398 5:135701835-135701857 TTTCCATGTGGAGGACAGGTTGG - Intergenic
998591589 5:143484899-143484921 TATCCAAGTGGTTCACAGTCTGG + Intergenic
999092456 5:148948551-148948573 TCTCCATCTGGAGAACAGGCAGG - Intronic
1000153854 5:158531143-158531165 TCTCCAAGTGGAGGTCAGGAAGG - Intergenic
1001196515 5:169677962-169677984 GGTCCACCTGGAGCACAGACTGG + Intronic
1002802609 6:539501-539523 TGTCCATTGGGAGCACTGGCTGG - Intronic
1006609981 6:35288658-35288680 TTTCAAAATGAAGCACAGGCCGG + Intronic
1008169110 6:48180643-48180665 TCTACAAGTGGAGTCCAGGCAGG - Intergenic
1009194605 6:60668939-60668961 TGTGAAACTGGAGCACAGACAGG + Intergenic
1010604256 6:77868859-77868881 TGCCCAAGTGCAGCACAGCCTGG + Intronic
1012143150 6:95648975-95648997 TGTACATGTGCAGGACAGGCAGG - Intergenic
1016907508 6:149166433-149166455 TGTCACAGTGGAGCACAGTTAGG - Intergenic
1017324842 6:153132045-153132067 TGCCCAAGTGGAGCCCAGCTTGG + Intergenic
1018469538 6:164083399-164083421 TGTCCAAGAGGACCACCTGCCGG + Intergenic
1019265689 7:116377-116399 GGTGCAGGTGGGGCACAGGCTGG - Intergenic
1021838589 7:24704521-24704543 AGTCCCAGTGGAGGCCAGGCTGG - Intronic
1024125406 7:46289942-46289964 TGTCAACCTGGAGCACAGTCTGG - Intergenic
1024903265 7:54346735-54346757 TTGCAAAGTGGAGCACAGACTGG + Intergenic
1025036149 7:55593594-55593616 TGTGCATGTGTAGCACAGGAAGG + Intergenic
1029478741 7:100800545-100800567 TGTCAAAACGGAGGACAGGCTGG + Intergenic
1032516517 7:132510084-132510106 TGTCCAATGGGAACACATGCAGG - Intronic
1032588699 7:133172385-133172407 TTTCCAGGTGGAGCATAGGTAGG - Intergenic
1034434639 7:151057530-151057552 TGTCCAAGTGCTGCTGAGGCTGG + Intronic
1034498781 7:151437083-151437105 TTTCCAAATGGACCACAGCCTGG + Intronic
1035592466 8:826689-826711 TGACCGAGTGAAGCACAGACGGG - Intergenic
1041944059 8:63422355-63422377 AGTACAAGTGGAGCAGAGGATGG - Intergenic
1048422934 8:134294986-134295008 TGTCCATGTGCAGGACAGGTTGG - Intergenic
1048487239 8:134859733-134859755 TGTCCATCAGCAGCACAGGCTGG + Intergenic
1049155670 8:141065315-141065337 TGGCCAATTGGGGCACAGGGCGG + Intergenic
1049576381 8:143391787-143391809 GGGCCAGGTGGGGCACAGGCAGG - Intergenic
1049655344 8:143794660-143794682 TCCCCAAGGGGAGGACAGGCTGG - Intronic
1051575198 9:18607203-18607225 TGTTCCAGTGAATCACAGGCTGG - Intronic
1051943359 9:22535589-22535611 TTTATAAGTGGAGCACAGGCTGG + Intergenic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1055583575 9:77732890-77732912 TGTGGAAGTGGAGCCCAGGCAGG - Intronic
1056790954 9:89625000-89625022 TGCCCAAGGAGAGCAGAGGCAGG + Intergenic
1058191313 9:101919472-101919494 AGTCCACCTGGAACACAGGCTGG + Intergenic
1058357809 9:104104866-104104888 TGCCCAGGAGGACCACAGGCAGG + Intronic
1060933737 9:127504389-127504411 TGGCCAAGTTGAGCCCAGGAGGG - Intergenic
1061150698 9:128826480-128826502 TGTCAAAGTGGAGACCAGGTAGG - Intronic
1061452405 9:130675420-130675442 TGTCCAGCAAGAGCACAGGCTGG - Intronic
1062340967 9:136093917-136093939 TGTCCCACTGGAGAACAGGAGGG + Intronic
1062623478 9:137433007-137433029 TCTGCAAGAGAAGCACAGGCTGG - Exonic
1203369404 Un_KI270442v1:288717-288739 AGTCCAATGGGAGCAGAGGCAGG + Intergenic
1185595094 X:1301493-1301515 TTTCCCAGTGGAGCAGAGGGAGG - Intronic
1185925631 X:4142677-4142699 GGTCCACCTGGAGCTCAGGCTGG - Intergenic
1189244501 X:39553063-39553085 TCTCCAAGTGGCCCACAGGGAGG + Intergenic
1189890279 X:45593912-45593934 TGTTCAAGTTAAGCACAGGAAGG - Intergenic
1192230644 X:69262549-69262571 TGGCCAACTTGACCACAGGCTGG + Intergenic
1192562361 X:72135523-72135545 TTTCCCAGCAGAGCACAGGCTGG - Intronic
1193877886 X:86884562-86884584 TGTCCATGTGGAGTACTGCCAGG + Intergenic
1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG + Intergenic
1200066621 X:153507110-153507132 TGTCCAAGTGGAGCTCCCGGAGG - Exonic
1200918663 Y:8593653-8593675 GGTCCATGGGGAACACAGGCAGG - Intergenic
1201065768 Y:10092788-10092810 TGTCAAGGGGGAGCAGAGGCAGG + Intergenic