ID: 1067972393

View in Genome Browser
Species Human (GRCh38)
Location 10:50987668-50987690
Sequence TGGCAATACCTGTGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067972393_1067972396 5 Left 1067972393 10:50987668-50987690 CCAGTTTTTCACAGGTATTGCCA No data
Right 1067972396 10:50987696-50987718 TACAACCACAGCAAGTATTTGGG No data
1067972393_1067972395 4 Left 1067972393 10:50987668-50987690 CCAGTTTTTCACAGGTATTGCCA No data
Right 1067972395 10:50987695-50987717 TTACAACCACAGCAAGTATTTGG No data
1067972393_1067972398 18 Left 1067972393 10:50987668-50987690 CCAGTTTTTCACAGGTATTGCCA No data
Right 1067972398 10:50987709-50987731 AGTATTTGGGAATAAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067972393 Original CRISPR TGGCAATACCTGTGAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr