ID: 1067972722

View in Genome Browser
Species Human (GRCh38)
Location 10:50991327-50991349
Sequence TTCTCGGGCGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067972722_1067972732 -6 Left 1067972722 10:50991327-50991349 CCGCCGCCGCCGCCGCCCGAGAA No data
Right 1067972732 10:50991344-50991366 CGAGAAAAAGTTTCGCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1067972722_1067972731 -7 Left 1067972722 10:50991327-50991349 CCGCCGCCGCCGCCGCCCGAGAA No data
Right 1067972731 10:50991343-50991365 CCGAGAAAAAGTTTCGCGGAGGG 0: 1
1: 0
2: 1
3: 0
4: 15
1067972722_1067972729 -8 Left 1067972722 10:50991327-50991349 CCGCCGCCGCCGCCGCCCGAGAA No data
Right 1067972729 10:50991342-50991364 CCCGAGAAAAAGTTTCGCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 12
1067972722_1067972733 22 Left 1067972722 10:50991327-50991349 CCGCCGCCGCCGCCGCCCGAGAA No data
Right 1067972733 10:50991372-50991394 TGAAAAAATGAGCGAGCTAGAGG 0: 1
1: 0
2: 1
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067972722 Original CRISPR TTCTCGGGCGGCGGCGGCGG CGG (reversed) Intergenic
No off target data available for this crispr