ID: 1067974470

View in Genome Browser
Species Human (GRCh38)
Location 10:51008441-51008463
Sequence TAGGGTTTTCAGAAAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067974470_1067974478 16 Left 1067974470 10:51008441-51008463 CCATGCTCTTTCTGAAAACCCTA 0: 1
1: 0
2: 5
3: 42
4: 383
Right 1067974478 10:51008480-51008502 TGCCTCTTTCTAGCTTCTGGTGG 0: 9
1: 80
2: 223
3: 1006
4: 1301
1067974470_1067974480 23 Left 1067974470 10:51008441-51008463 CCATGCTCTTTCTGAAAACCCTA 0: 1
1: 0
2: 5
3: 42
4: 383
Right 1067974480 10:51008487-51008509 TTCTAGCTTCTGGTGGTTGCTGG No data
1067974470_1067974477 13 Left 1067974470 10:51008441-51008463 CCATGCTCTTTCTGAAAACCCTA 0: 1
1: 0
2: 5
3: 42
4: 383
Right 1067974477 10:51008477-51008499 CCTTGCCTCTTTCTAGCTTCTGG 0: 7
1: 77
2: 212
3: 337
4: 631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067974470 Original CRISPR TAGGGTTTTCAGAAAGAGCA TGG (reversed) Intronic
901467146 1:9429458-9429480 TACGGTATTCAGAAAGCGAAGGG - Intergenic
901816716 1:11798128-11798150 TAGGAATTTCAGAAACAACAAGG + Intronic
902076204 1:13788747-13788769 GAGTGTTGTGAGAAAGAGCACGG + Intronic
902827242 1:18984963-18984985 TAGTATTTGCAGAAAAAGCAGGG + Intergenic
902879950 1:19365420-19365442 GTGGATTTCCAGAAAGAGCACGG + Intronic
903373981 1:22854201-22854223 TGGGGGTTTTAGAAAGAACATGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905180579 1:36163158-36163180 TGGGGTCTGCAGAAAGATCAGGG - Intronic
905520245 1:38593505-38593527 TAGAGTCATCAGAGAGAGCATGG - Intergenic
906179351 1:43805033-43805055 TTGGGTTCTCATAAAGGGCAGGG - Intronic
906333664 1:44909280-44909302 GTGAGTTTTCAGAAAGAGGATGG - Intronic
907580972 1:55572480-55572502 TAGAGTTTTCAGAGGGAACATGG - Intergenic
907794425 1:57700782-57700804 GAGGGAATTGAGAAAGAGCAAGG - Intronic
908448060 1:64221039-64221061 TATTGTTTTCAGAAAGAACATGG + Intronic
908902201 1:68968648-68968670 GAGGGTTTTAAGCAAGGGCAGGG - Intergenic
910747764 1:90591751-90591773 TCAGGTTTTCACAAAGGGCAAGG + Intergenic
911450658 1:98056236-98056258 TAGCATTTTCAGAAAAACCAAGG - Intergenic
911657931 1:100465830-100465852 TAGGGCTTTCAGAAAATGCCTGG + Intronic
912119984 1:106459138-106459160 CATGCTTTTCAGAAAGAGGATGG + Intergenic
912272238 1:108223332-108223354 AAGCGTTTTCAGCAAGAACATGG + Exonic
912855533 1:113165805-113165827 TAGAGCCTTCAGAGAGAGCACGG - Intergenic
915503199 1:156334496-156334518 TAGAGACTTCAGAAGGAGCATGG + Intronic
915707155 1:157855641-157855663 TAGAGGCTTCAGAGAGAGCATGG - Intronic
915962285 1:160277119-160277141 TAGGGTCTTCAGAGAGACCGAGG + Exonic
916354891 1:163893916-163893938 CAGAGTTTTCAGGAAGAGAAAGG + Intergenic
916762727 1:167831942-167831964 TGGGGTTTCCAGAAACAGCCAGG + Intronic
917038564 1:170777127-170777149 TATGATTTTCAGAAAGGACAAGG - Intergenic
917410210 1:174751708-174751730 TATGGTTTTCAGAAAAGGAAAGG + Intronic
917500956 1:175584394-175584416 TAGAGACATCAGAAAGAGCATGG + Intronic
918885830 1:190193117-190193139 CAGGATTTTCAGAAAGAGTAAGG - Intronic
921540759 1:216411756-216411778 TAGAGGTTTCAGAAAGAGCATGG + Intronic
921625832 1:217376870-217376892 TAGTATCTTCAGAAAGGGCAGGG + Intergenic
923177807 1:231484927-231484949 CAGGCATTTCAAAAAGAGCATGG + Intergenic
923387628 1:233480911-233480933 TAGGGAGTTCAGAAATTGCAGGG + Intergenic
923629901 1:235642945-235642967 CAGGGTTTCCAGACTGAGCATGG - Intronic
1063352314 10:5366842-5366864 GAGGGTTTGCAGAGAGAGAAAGG + Intronic
1063690639 10:8283938-8283960 CTGGGTTTTTAGAAAGAGGAAGG - Intergenic
1064839297 10:19572878-19572900 CAGAGTCTTCAGAGAGAGCAGGG + Intronic
1065424789 10:25588712-25588734 AGTGGTTTTCAGAAAAAGCAAGG + Intronic
1065609405 10:27457161-27457183 TAGTCTTTACAGAAGGAGCAGGG + Intergenic
1065899623 10:30194067-30194089 TAGGATTTTCAGAATGGCCAAGG - Intergenic
1066164912 10:32776406-32776428 TAGGGATAGCATAAAGAGCAAGG - Intronic
1066763585 10:38782286-38782308 GATGGATTTCAGAAATAGCAAGG + Intergenic
1067328184 10:45289744-45289766 TAGAGCCTTCAGAGAGAGCATGG - Intergenic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1068128233 10:52867253-52867275 TAAAGGTTTCAGAAGGAGCATGG - Intergenic
1069987560 10:72294823-72294845 AAGGCTTTTCAATAAGAGCAGGG + Intergenic
1070385163 10:75917630-75917652 CAGGGTGATAAGAAAGAGCAAGG + Intronic
1070590539 10:77797585-77797607 GAGAGTCTCCAGAAAGAGCAGGG + Intronic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1073250830 10:102119634-102119656 CAGGGTCCTCAGAAACAGCATGG + Intronic
1074094604 10:110299834-110299856 TAGTTTTTTCAGAAATAGCCAGG - Intronic
1074423192 10:113327626-113327648 TGGGTTTTTTATAAAGAGCAAGG - Intergenic
1074475235 10:113767763-113767785 TGGAGTCTTCAGAGAGAGCATGG - Intronic
1074538138 10:114343622-114343644 AAGTGTTTGCACAAAGAGCATGG + Intronic
1074713714 10:116199088-116199110 TAGAGCCTTCAGAGAGAGCATGG + Intronic
1074760971 10:116667272-116667294 TAGCGCCTTCAGAAAGAGCATGG + Intronic
1075955656 10:126520719-126520741 TAGGGCCTTCAGAGGGAGCACGG - Intronic
1076268343 10:129129029-129129051 AAGGGACTTCAGAAAGAGCCAGG - Intergenic
1077013213 11:388713-388735 GAGGGTTTCCAGACAGTGCAGGG + Intergenic
1078112132 11:8404109-8404131 TATGGTTTTCAGAAGAAGGAAGG + Intronic
1079619501 11:22535878-22535900 TAGAGGCTTTAGAAAGAGCACGG - Intergenic
1080164202 11:29217322-29217344 GAGGGTTTTGATAAAGACCATGG - Intergenic
1080208883 11:29762142-29762164 TAGAGTTTTTAGCAAGAACATGG + Intergenic
1081826322 11:46056792-46056814 CAGGGTTTTCAGGAAGCACAAGG - Intronic
1083473839 11:62902750-62902772 TACGGGTTTCAGAAGGAGCACGG + Intergenic
1085115547 11:73928408-73928430 AAGGGTTTTAAGCAAGAGAATGG + Intergenic
1085448460 11:76616518-76616540 TGGGGTTTGCAGAAACTGCACGG - Intergenic
1085809024 11:79663663-79663685 GAGGGTCTTCAGAAAAAGCATGG + Intergenic
1086812683 11:91330318-91330340 TAGAGTTTTCAGAGAAAGTATGG - Intergenic
1087229742 11:95646968-95646990 CGGGGTTTTTTGAAAGAGCAGGG - Intergenic
1088115184 11:106304802-106304824 TAGGGCTATCAAAAAGATCATGG + Intergenic
1088544102 11:110942562-110942584 TAGGGGATTCAGTAAGAGCCAGG - Intergenic
1089474822 11:118750811-118750833 TAGGTTTACCAGAGAGAGCAAGG - Exonic
1089981748 11:122778311-122778333 AAGGGTTTTGAGAAAGATCCTGG - Intronic
1090170356 11:124596988-124597010 TAAGGATTCCAGAAAGAGAAAGG - Intergenic
1091519281 12:1219825-1219847 CAGGGTTTTGCCAAAGAGCAGGG + Intronic
1091820348 12:3471295-3471317 TGGGGTTTGCAGAGAGAGTAGGG - Intronic
1092793297 12:12087781-12087803 TAGGGCTTTGTGAAAAAGCAGGG + Intronic
1093069010 12:14688852-14688874 TTGGCATTTCAGAAAGAACAGGG + Intronic
1094073771 12:26450145-26450167 GAGGGCCTTCAGAGAGAGCATGG + Intronic
1095254020 12:40012460-40012482 AAGTGTTTCCAGAAAGATCAAGG + Intronic
1095265731 12:40155040-40155062 CAGGATTTTCAAAAAGAACAAGG - Intergenic
1095885736 12:47186691-47186713 TACAGCTTTCAGAAGGAGCATGG + Intronic
1096484613 12:51970229-51970251 AAGTGTTGTCAGAAAGAGCGTGG + Intronic
1098204900 12:68098417-68098439 TAGAGCCTTCAGAGAGAGCACGG - Intergenic
1098766750 12:74499983-74500005 TACAGGTTTCAGAGAGAGCAAGG - Intergenic
1099009304 12:77272723-77272745 TCTGGGTTTCAGAAGGAGCAAGG + Intergenic
1099202732 12:79693963-79693985 TAGGGTTTTCAGAATGGATAAGG - Intergenic
1099513535 12:83567749-83567771 TATGGGTTTCAGAAGAAGCATGG + Intergenic
1099664304 12:85608136-85608158 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1099669045 12:85667517-85667539 TAGAGCCTTCAGAGAGAGCATGG + Intergenic
1099869053 12:88322999-88323021 TAGAGCCTTCAGAGAGAGCATGG + Intergenic
1100097693 12:91063084-91063106 AAGGGTTTTCAGAGAGGGAAAGG - Intergenic
1102665721 12:114571136-114571158 CAAGGTTTTCAGAAGGAGCTTGG - Intergenic
1103024526 12:117562844-117562866 TGGGGTTTTCTGCATGAGCAAGG - Intronic
1103498870 12:121384948-121384970 TAAGGGTTTCAGAATGAGGATGG + Intronic
1103845914 12:123902023-123902045 TAGAGCTTTCAGAGGGAGCATGG - Intronic
1106465161 13:30006916-30006938 CAGTGCTTTCAGAAGGAGCACGG + Intergenic
1106650641 13:31686530-31686552 TAGAGTCTTCAGAGAAAGCATGG - Intergenic
1106859835 13:33893918-33893940 GAGGGAGTTCAGCAAGAGCAAGG + Intronic
1106873250 13:34044326-34044348 TAGGGTGTTCAGAGAGTGCCTGG + Intergenic
1107335133 13:39346743-39346765 CAGGGTTTTAAGTAAGAGCATGG - Intronic
1107710111 13:43142982-43143004 TAGGGCTTTCAGAGGGAGCGTGG + Intergenic
1107856975 13:44625731-44625753 TAAAGTTTCCAGAAAGAGAATGG - Intergenic
1108486129 13:50927555-50927577 AAAGCTATTCAGAAAGAGCAAGG - Intronic
1108564277 13:51679755-51679777 TACAGCTTTCAGAAGGAGCATGG - Intronic
1108697247 13:52913350-52913372 TAGAGTCCTCAGAAAGAGCACGG - Intergenic
1109882059 13:68492015-68492037 TACGGTTTTTATGAAGAGCAAGG + Intergenic
1110476196 13:75916790-75916812 TAGAGCCTTCAGAAAGAGAAAGG + Intergenic
1110826091 13:79974027-79974049 TTGGGCTTGCAGGAAGAGCAGGG - Intergenic
1111086057 13:83376176-83376198 TATGCTTTTGAGAAAGAACAAGG + Intergenic
1113047379 13:106170401-106170423 GGGGGTGTTCAGGAAGAGCAAGG - Intergenic
1113216657 13:108048767-108048789 TAGAGGCTTCAGAGAGAGCATGG - Intergenic
1113662514 13:112117217-112117239 TAGAGATTTCAGAGACAGCACGG + Intergenic
1114944318 14:27659958-27659980 TACAGGTTTCAGAGAGAGCATGG + Intergenic
1116601655 14:46932753-46932775 TTGGGTTTTCAGAAATAACATGG + Intronic
1116676422 14:47911738-47911760 TAGGGTGTTCAGGAATACCAAGG - Intergenic
1116751699 14:48894313-48894335 TAGAGCTTTCAGAGAGAGCATGG - Intergenic
1116877831 14:50131425-50131447 AGGGGTTTTCAAAAAGTGCATGG + Intronic
1117847290 14:59924598-59924620 TAGGGTTTGGAGCAAAAGCAGGG - Intronic
1118502301 14:66373166-66373188 TGGGTTTTTTAGAAAGAGAAGGG - Intergenic
1119189785 14:72673184-72673206 TAAGGTTTGCAGACAGAGCAAGG + Intronic
1120117594 14:80637944-80637966 TAGGGTTTTCAGAGGGAGTCAGG + Intronic
1120384569 14:83827896-83827918 CAGGTGTTTCAGAAAGGGCAAGG - Intergenic
1120713402 14:87816089-87816111 TAGGGCCTTCAGAAGGAGCTTGG - Intergenic
1121418950 14:93798903-93798925 TGAGGGTTTCAGAAATAGCAAGG - Intergenic
1121772803 14:96564984-96565006 TAGGATTTGCAGGGAGAGCAGGG - Exonic
1124903480 15:33846187-33846209 TTGGGTTTCCAAAAAGAGCATGG + Intronic
1125349778 15:38754661-38754683 TAGGGTGTTGAGACAGAGGAGGG + Intergenic
1126672270 15:51127241-51127263 TAGAGTCTTCAGAGGGAGCACGG - Intergenic
1126785748 15:52176807-52176829 GAGGGTTTTGAGAGAGAGGATGG - Intronic
1126898052 15:53281085-53281107 GAGGATATTCAGAAAGACCAGGG + Intergenic
1128770320 15:70277119-70277141 CAGGGGTTACAGAAAGAGCGTGG - Intergenic
1129603887 15:77015462-77015484 TAGAGATTTCACAAAGGGCAGGG + Intronic
1130302456 15:82690121-82690143 TATGGGTTTCAGAGGGAGCATGG + Intronic
1131003711 15:88958706-88958728 TAGGGTTTTCAGACCCAACAGGG - Intergenic
1131483610 15:92802438-92802460 TGGAGGCTTCAGAAAGAGCATGG - Intronic
1131765342 15:95669459-95669481 TAGGTTTTTAAGAAAAAGAAAGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133837409 16:9379174-9379196 TACGGCCTTCAGAAAGAACATGG - Intergenic
1134016412 16:10891621-10891643 TAGGTTCTTAATAAAGAGCATGG + Intronic
1135872971 16:26169257-26169279 AAGGGTTTTCAGGAAGAGAAGGG + Intergenic
1136709287 16:32222024-32222046 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136758623 16:32707395-32707417 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1136809485 16:33162984-33163006 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136815961 16:33273064-33273086 TAGGGTCTTCAGAGGGAGTATGG - Intronic
1137759572 16:50929235-50929257 TAGAGTCTTCAGACGGAGCATGG - Intergenic
1138909350 16:61377654-61377676 TAGAGCCTTCAGAGAGAGCATGG - Intergenic
1140859320 16:79005498-79005520 TAGAGTTTTCAGAGAGAGGATGG - Intronic
1141109804 16:81262939-81262961 TAGAGTCTTCAGAGAGAGCATGG - Intronic
1141772951 16:86101901-86101923 TTGGGTTTTTGGAAAGAGCTTGG + Intergenic
1203060777 16_KI270728v1_random:967723-967745 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1143225407 17:5298090-5298112 TGGGCTTTTCCGAAATAGCAAGG - Intronic
1143701214 17:8661684-8661706 TAGAGTCTTCAGAGAGAGCATGG - Intergenic
1145746411 17:27323489-27323511 TGGGGTTTTCATAAATAGCCAGG - Intergenic
1145981936 17:29018007-29018029 ATGGGGTTTCAGAAAGAGCAGGG - Intronic
1147922842 17:43928914-43928936 TAGGTTTTGAAGAAAAAGCAAGG + Intergenic
1147997355 17:44367900-44367922 TAGTGTGTTCAAAAAAAGCAAGG - Intergenic
1149620763 17:58043345-58043367 CACTGTTTTCAGAAAGTGCAGGG + Intergenic
1150976510 17:70093301-70093323 TAGAGGCTTCAGAAGGAGCAAGG - Intronic
1151254154 17:72862590-72862612 AAAGGTTTTGAGAAGGAGCAAGG + Intronic
1151397325 17:73832198-73832220 TAGAGCCTTCAGAGAGAGCATGG - Intergenic
1151449192 17:74187344-74187366 TGGGGTTCTCAGACAGAGAAGGG - Intergenic
1151953884 17:77371114-77371136 TTGGGTTTCCTGAAAGAGCTCGG + Intronic
1152307300 17:79528796-79528818 TAGAGTTTTCAGAGGGAGCACGG + Intergenic
1152512626 17:80800759-80800781 TAGGGTTTTCAGAAAGCTCCGGG + Intronic
1153050038 18:893512-893534 TACAAGTTTCAGAAAGAGCATGG - Intergenic
1154153548 18:11926507-11926529 TAGGGCTTCCAGAAAGAACACGG - Intergenic
1155437378 18:25827298-25827320 CAGTGTCTTCAGAGAGAGCAGGG - Intergenic
1155581402 18:27312210-27312232 TAGAGCATTCAGAGAGAGCATGG - Intergenic
1155735546 18:29218330-29218352 TGGGATTTTCAGGAAGAACATGG + Intergenic
1155927533 18:31673022-31673044 GAAGGTTTTCTGGAAGAGCAGGG + Intronic
1156243897 18:35279253-35279275 TAGAGCTTTCAGAGAGAGTATGG - Intronic
1157414246 18:47488974-47488996 TAGAGTTTACAGAAGTAGCAGGG + Intergenic
1157645242 18:49262301-49262323 TAGAGCCTTCAGAGAGAGCATGG + Intronic
1158053263 18:53249422-53249444 TAGGGTTTTATGACAGATCAAGG + Intronic
1158218976 18:55130088-55130110 TAGAGATTTCAGAAGGAGTACGG + Intergenic
1158684264 18:59598790-59598812 GAGGGTTTTCAAAAAGATCATGG - Intronic
1159910844 18:74144854-74144876 TAAGGTTTTCAGTAAGAACTTGG - Intronic
1161177583 19:2855728-2855750 TAGCATCTTCAGAAAAAGCATGG - Exonic
1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG + Intronic
1166172823 19:41043780-41043802 TACAGGTTTCAGAAAGAGCATGG + Intergenic
925264679 2:2558802-2558824 TAGGGCCTTCAGAGAGAGCATGG - Intergenic
926388658 2:12364160-12364182 TAGGCATTTCAGAAAAAGGATGG + Intergenic
926389898 2:12378831-12378853 CAGGTTTTTCAGAATGATCAGGG + Intergenic
926457165 2:13081045-13081067 TAGGATTGGCAGAAAGAGTATGG - Intergenic
927235263 2:20867905-20867927 TGGAGTCTTCAGAAACAGCATGG + Intergenic
928712468 2:34022681-34022703 AAGGGTTTTAAGCAAGAGGATGG + Intergenic
929745214 2:44650162-44650184 TAGGGGTTTCAGATGGAGCATGG - Intronic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
930061965 2:47297334-47297356 TGGGGTTTTCAGAAAGTCCTTGG - Intergenic
930428764 2:51247024-51247046 TAGAGCCTTCAGAGAGAGCATGG - Intergenic
932915003 2:75847733-75847755 TAGGGCTTTCAGAAAACTCATGG - Intergenic
933286650 2:80391534-80391556 TATGATTTTCAGAAGGATCATGG + Intronic
936558314 2:113515023-113515045 TAGCATCTTCAGAGAGAGCATGG - Intergenic
936656547 2:114494757-114494779 CAGGGTTTTCTGCAAGAGTAAGG + Intronic
936671293 2:114659959-114659981 CACAGTCTTCAGAAAGAGCATGG + Intronic
937673619 2:124564999-124565021 TTGGGGATGCAGAAAGAGCATGG + Intronic
937942586 2:127297461-127297483 TATGGGTGTCAGAAGGAGCATGG + Intergenic
939283865 2:140102424-140102446 TAGAGATTTCAGAGACAGCATGG + Intergenic
939335907 2:140827664-140827686 AAGGGAGTTGAGAAAGAGCAAGG + Intronic
939794780 2:146629467-146629489 TAGAGTCTTCAGAGAGATCAAGG - Intergenic
940254950 2:151718699-151718721 TGGGGTTGTGAGAAAGAGGAGGG - Intronic
941301389 2:163806989-163807011 AAGGATTTTCTGAAAGAGAATGG + Intergenic
942235550 2:173900953-173900975 TAAAGTTCACAGAAAGAGCAAGG + Intergenic
942286173 2:174419231-174419253 TAGGGTTTTGAGAGAGAGGAAGG + Intronic
943458666 2:188141490-188141512 GAGGGGTTTTAGAAAGAGAAAGG + Intergenic
945221504 2:207488946-207488968 TAGAGTTTCCAGAGAAAGCACGG - Intergenic
945335551 2:208588619-208588641 TAGAGGTTTCAGAGGGAGCATGG + Intronic
946080890 2:217117310-217117332 TAGAGTGTTGAGAGAGAGCATGG - Intergenic
946677542 2:222177862-222177884 TGGAGTGTTCAGAAATAGCAAGG + Intergenic
946747700 2:222861670-222861692 AAGGGTTTTCCGAAATCGCAGGG - Intronic
946982761 2:225235985-225236007 TGGGGTCTTCAGAATGAGAATGG - Intergenic
948321231 2:237071507-237071529 AAGGGTTATCAGGAAGAACATGG + Intergenic
1168815359 20:733050-733072 TAGGGCTTTCAGAGAGAGCATGG + Intergenic
1170091793 20:12597215-12597237 TATCGGTTTCAGAGAGAGCATGG - Intergenic
1171118426 20:22547416-22547438 TAGGATTTTCACAAATAGCAAGG + Intergenic
1171309345 20:24134147-24134169 GAGGGGTGACAGAAAGAGCATGG + Intergenic
1173258046 20:41408989-41409011 CATGGTTCTCAGCAAGAGCAGGG - Intronic
1173944259 20:46937887-46937909 CAGGGGTTTCAAAGAGAGCATGG + Intronic
1174315094 20:49693538-49693560 TAGGGCCTTTAGAAACAGCAAGG - Intronic
1174633568 20:51979449-51979471 TGGAGGTTTCAGAAAGGGCACGG + Intergenic
1174727543 20:52878603-52878625 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1175673398 20:60926316-60926338 TAGAGCTCTCAGAAACAGCAGGG - Intergenic
1177943904 21:27443958-27443980 TACAGGTTTCAGAGAGAGCATGG + Intergenic
1178734666 21:35138067-35138089 TACAGTTTTCAGAGGGAGCATGG - Intronic
1178738574 21:35175404-35175426 TAGAGGTTTCAGAGAGAGTATGG + Intronic
1179145804 21:38766375-38766397 TACAGTCTTCAGAAGGAGCAAGG + Intergenic
1179384880 21:40932639-40932661 AAGAGTTTTCAGAGACAGCATGG + Intergenic
1180020955 21:45126674-45126696 AAGGGGTTTCAGGAAAAGCATGG - Intronic
1180122039 21:45759677-45759699 TTGGTTTTCCAGAAAGAGAAGGG + Intronic
1181839737 22:25646424-25646446 TTGGAGTTTCAGAAAGAGAAGGG + Intronic
1181947431 22:26529084-26529106 AAGGGGTCTCAGAAAGACCAAGG + Intronic
1182059374 22:27386085-27386107 GAGGGTTTTCACTAAAAGCAGGG + Intergenic
1183123315 22:35749765-35749787 TAAGTTTTTCAAAAAGAACAAGG + Intronic
1183204044 22:36406166-36406188 AAGTGTTTTCAGAAAGTGCCTGG - Intergenic
1184379537 22:44136448-44136470 TGGGGTTTTCAGAAACGGGAAGG + Exonic
951958627 3:28288456-28288478 TACGGTAATGAGAAAGAGCAAGG - Intronic
954974852 3:54683791-54683813 TAGAGTTTTCAGAGAGACCACGG - Intronic
957508861 3:81161121-81161143 TAGGGTTTTCAGAAAGATTATGG - Intergenic
958184305 3:90100235-90100257 TAGGTTCTTCAGACTGAGCATGG + Intergenic
958573482 3:95917001-95917023 TTCGTTTTCCAGAAAGAGCAGGG + Intergenic
958799995 3:98744184-98744206 TACAGTTTTCAGAGGGAGCATGG + Intronic
958813478 3:98890394-98890416 TAGAGTCTTAGGAAAGAGCATGG + Intronic
960044182 3:113180219-113180241 TTGGGTCTTCAGAAAGTGAAAGG + Intergenic
960626240 3:119685069-119685091 TGGGGTTTTCAGAAAGGGAAGGG - Intergenic
960765670 3:121127408-121127430 TAGAGTCTTCAGAGGGAGCACGG - Intronic
961033158 3:123623981-123624003 TAGGGTTTTCTGGAAGGGCGGGG - Intronic
961411763 3:126727319-126727341 AAGGGCTTTCCGGAAGAGCATGG + Intronic
962202358 3:133412469-133412491 GGGAGTTTCCAGAAAGAGCAGGG + Intronic
962625786 3:137224545-137224567 TACAGGTTTCAGAGAGAGCATGG - Intergenic
963308576 3:143682098-143682120 TAGGGTTTGCATAAAGCTCAAGG + Intronic
963919020 3:150888126-150888148 GAGGGCCTTCAGAGAGAGCATGG - Intronic
964519676 3:157551143-157551165 GAGGGTATTGAGCAAGAGCATGG - Intronic
965044418 3:163557352-163557374 TAGTGTCTTCAGATGGAGCATGG - Intergenic
965132103 3:164714340-164714362 TAGTGCCTTCAGAGAGAGCATGG - Intergenic
965866326 3:173208438-173208460 TAAGGTTTTGAGAAAGGGGATGG - Intergenic
967240207 3:187431127-187431149 TTGGGTTTACAGAGAGGGCAAGG - Intergenic
967703659 3:192623574-192623596 TTTGTTTTGCAGAAAGAGCAAGG + Intronic
967735041 3:192942824-192942846 TAGAACTTTCAGAGAGAGCATGG + Intergenic
967915429 3:194574784-194574806 TAGGGTTCTCAGAAAACTCAGGG + Intergenic
968445132 4:648604-648626 GAGGCTTTTCAGAAAGGGAATGG - Intronic
969280772 4:6169473-6169495 TAGAGCTTTCAGAGAGAGCATGG + Intronic
969820639 4:9717550-9717572 TAGCATCTTCAGAGAGAGCATGG + Intergenic
970559697 4:17270466-17270488 ATGGGTTTTCAGACAGAGCGAGG - Intergenic
971381422 4:26102013-26102035 TAGTTTTTTCAGACAAAGCATGG - Intergenic
972964216 4:44489367-44489389 TAGGATTTTCAGCAAAAGCTAGG - Intergenic
972976334 4:44640942-44640964 CTTGGGTTTCAGAAAGAGCATGG + Intronic
973863782 4:55091534-55091556 TAGGGTTTTCCCAAAGAGAAAGG - Intronic
974813058 4:66970703-66970725 TAGAGATTACAGTAAGAGCATGG + Intergenic
975729092 4:77320151-77320173 TAGGGTTTTCAAAAAGGGAGGGG + Intronic
976339712 4:83933622-83933644 TAGAGCCTTCAGCAAGAGCATGG - Intergenic
976544387 4:86317883-86317905 TAGAGCCTTCAGAGAGAGCATGG - Intronic
977082517 4:92549763-92549785 TAGGATTTTAAGAAACATCACGG - Intronic
977354517 4:95927979-95928001 TGGGGTTTTAAGGAAGAGTATGG + Intergenic
978817683 4:112927607-112927629 TAGATTTTTCAGAAAAAGCAAGG - Intronic
979162638 4:117483101-117483123 TAGAGCTTTCAGAGGGAGCATGG - Intergenic
979163645 4:117497008-117497030 TAAAGTTTTCAGAGGGAGCATGG + Intergenic
979508447 4:121524796-121524818 TAGAGTCTTCAGAGAGAGCATGG + Intergenic
979845079 4:125498339-125498361 TAGTGTTCTAAGAAAGAGGATGG + Intergenic
980905717 4:138946920-138946942 TAGACTTTTCAGGAAGACCAGGG + Intergenic
981141858 4:141278265-141278287 TAGAGTCTTCAGAAGGAACATGG + Intergenic
981146513 4:141331918-141331940 TAGAGATTTCAGGAAGAGTATGG + Intergenic
982038840 4:151374693-151374715 TAGAGTTTTGATAAAGAACAAGG - Intergenic
982309666 4:153971798-153971820 TAGAGCATTCACAAAGAGCAGGG - Intergenic
983129415 4:163996879-163996901 TAGTGCTTTCAGAGTGAGCATGG + Intronic
983860911 4:172706066-172706088 CAGGGAGTTGAGAAAGAGCAAGG - Intronic
986215624 5:5716397-5716419 TAGAGCTTTCAGAGAAAGCAGGG + Intergenic
986818991 5:11445118-11445140 TGGAGTGCTCAGAAAGAGCATGG - Intronic
987179115 5:15347892-15347914 TAGAGTTGTTAGAGAGAGCATGG + Intergenic
988173182 5:27685436-27685458 TAGAGCTTTCAGAGGGAGCATGG - Intergenic
988364766 5:30282717-30282739 TAGAGTCTTCAGAGAAAGCATGG - Intergenic
988483308 5:31647464-31647486 TAGAGCTTCCAGAAGGAGCACGG - Intronic
988650387 5:33142419-33142441 TAGAGTCTTCATAAAGAGCATGG + Intergenic
990370383 5:55112267-55112289 TATGGTTTTCATAAAGAAAAAGG - Intergenic
990389001 5:55299553-55299575 TAGAGCCTTCAGAGAGAGCATGG - Intronic
990529931 5:56663412-56663434 CAGGGTTTTTGGAAAGAGAAAGG - Intergenic
991076022 5:62539209-62539231 TAGACCCTTCAGAAAGAGCAAGG - Intronic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
992287035 5:75246665-75246687 TAGAACCTTCAGAAAGAGCATGG - Intergenic
992567951 5:78020691-78020713 AAAGATTTTAAGAAAGAGCAAGG - Exonic
992718591 5:79535991-79536013 TAGGGTTGTGAGAATGGGCAAGG + Intergenic
993211107 5:84952302-84952324 CTGGCTTTTCAGAAAGAGAAAGG - Intergenic
993308308 5:86296658-86296680 AAGCGTTTTCAGCAAGAACATGG - Intergenic
993349984 5:86838233-86838255 TACAGGTTTCAGAGAGAGCATGG - Intergenic
993610568 5:90049001-90049023 TAGGTTTCTGACAAAGAGCATGG - Intergenic
993964522 5:94345147-94345169 GATGGTGTTCAGAAAGAGCGTGG + Intronic
995418460 5:111935942-111935964 TAGAGCCTTCAGAGAGAGCATGG - Intronic
995446933 5:112254930-112254952 CAGGGTCTTCAGAGAGAGCCAGG - Intronic
995838004 5:116417072-116417094 TTGGGTATTCAGATATAGCAGGG - Intergenic
996004269 5:118402293-118402315 GAGGGTTTGCAGAAATAACACGG - Intergenic
996483321 5:124000437-124000459 TAGGGTTTTGAGAGATGGCATGG - Intergenic
997133642 5:131301856-131301878 TAGGGGTATCAGAAAGGGAAGGG - Intronic
997192677 5:131952985-131953007 TAGGGTTTCCAGGCATAGCATGG + Exonic
1001212953 5:169827772-169827794 TAAGCTTTCCAGAAAGAGCTGGG + Intronic
1001432846 5:171676954-171676976 TAGAGTCTTCAGAGAGGGCATGG - Intergenic
1002069905 5:176673002-176673024 TAGTGTTTTCAAAAGGAGAATGG - Intergenic
1002474641 5:179457376-179457398 TAGGACCTTCAGAAAGACCATGG + Intergenic
1007198369 6:40083390-40083412 TAGGGTTTTCAGTAAAATCCTGG - Intergenic
1007307064 6:40915193-40915215 TAGGGTCTTCAGAGAGAGCATGG - Intergenic
1007545584 6:42691383-42691405 TTGGGTTTTAAGATCGAGCAAGG + Exonic
1009516566 6:64626686-64626708 TAGAGTTTTCAGAGGGAACATGG + Intronic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1009801507 6:68543141-68543163 TAAAGCCTTCAGAAAGAGCATGG + Intergenic
1009952884 6:70416874-70416896 TAGGTTTTTCAGAAGGAATAAGG + Intronic
1010067323 6:71698971-71698993 TACTGTTTTCAGAAAGTACAGGG + Intergenic
1011198209 6:84804575-84804597 TGGGGTTTTCAGGGAGAGCATGG - Intergenic
1011936631 6:92786789-92786811 TAGAGCCTTCAGAGAGAGCATGG + Intergenic
1012241427 6:96877510-96877532 TAGAATTTTGAGAAAGATCAGGG - Intergenic
1013041497 6:106438439-106438461 TAGAGCCTTCAGAAGGAGCACGG - Intergenic
1013308605 6:108872734-108872756 AAGGGTTTTCAGCAAGAGGGTGG - Intronic
1013398578 6:109768923-109768945 CTGGGTTTTCAGAGGGAGCATGG - Intronic
1013784247 6:113761951-113761973 TCTGGTTTCCAAAAAGAGCAAGG - Intergenic
1014240967 6:119017087-119017109 TAGTGTTCTCAGAAAGTGAAAGG + Intronic
1014655291 6:124096487-124096509 AAGGATTTTCAGAAATAACATGG - Intronic
1015332547 6:131997566-131997588 TAGAGCCTTCAGACAGAGCATGG + Intergenic
1015514493 6:134070762-134070784 TGGGATTTTCAGAGAGAGCAGGG - Intergenic
1015904072 6:138098318-138098340 TGGGGCTGGCAGAAAGAGCAAGG + Intronic
1015947457 6:138517328-138517350 TAGGGTTTGCAGAAACTGGATGG + Intronic
1016647460 6:146426371-146426393 CAGGGTTTTAAGAAATAGCCTGG + Intronic
1018041175 6:159923335-159923357 TAGTGCTTTCAGAATGAGCATGG + Intergenic
1022337378 7:29434439-29434461 TAGAGCCTTCAGAGAGAGCATGG - Intronic
1022499876 7:30876115-30876137 TATGGGTTTCAGAGGGAGCATGG - Intronic
1023170645 7:37387312-37387334 TAGTGCTTTCAGAGGGAGCAGGG - Intronic
1023487714 7:40704456-40704478 TAGGGGTATTGGAAAGAGCAAGG + Intronic
1024134574 7:46393223-46393245 GTGGGTTTTCAGAAGGAGCTTGG - Intergenic
1024537003 7:50444718-50444740 TAACATTTTCAGAAATAGCAAGG - Intronic
1024657087 7:51459996-51460018 CAGGATTCCCAGAAAGAGCAAGG + Intergenic
1024923897 7:54591864-54591886 GATCATTTTCAGAAAGAGCAGGG - Intergenic
1026569656 7:71518165-71518187 GAGGGTTTTAAGCAGGAGCATGG + Intronic
1027216295 7:76185953-76185975 TAGGGTTTGCAGCAGGAGCTGGG - Intergenic
1027706669 7:81542872-81542894 TAGCGTGTTCAGAGAGAACATGG + Intergenic
1028017024 7:85728882-85728904 TTGGGTTTTCAGAAACAAAATGG - Intergenic
1030299166 7:107957907-107957929 AAGGGTTTTGAGAATGAGAAAGG - Intronic
1031117970 7:117688795-117688817 TAGAGCCTTCAGAGAGAGCATGG - Intronic
1031532181 7:122887894-122887916 AAAGGTCTTCAGTAAGAGCATGG + Intergenic
1032018249 7:128393073-128393095 AAGGGTTTTGGGAAGGAGCAGGG - Intronic
1033796840 7:144855355-144855377 TTGGGTTTTCAATAAAAGCAAGG - Intergenic
1034150592 7:148912126-148912148 TAGAGCCCTCAGAAAGAGCATGG - Intergenic
1034161291 7:148995842-148995864 TTTGGTTTTCACAAAGAGGAGGG + Intergenic
1034868821 7:154664366-154664388 TAAGATATTCAGAAACAGCAGGG - Intronic
1035848517 8:2890774-2890796 TGGGTTTTTGAGGAAGAGCAAGG + Intergenic
1036623208 8:10442378-10442400 TAGGACCTTCAGAGAGAGCATGG + Intergenic
1037702878 8:21290844-21290866 TAGGTTTATGAGCAAGAGCAGGG - Intergenic
1038257793 8:25966614-25966636 TAGGATTTTGAGAAAGAACTCGG - Intronic
1038928554 8:32167868-32167890 TAGCTGTTTCAAAAAGAGCAAGG - Intronic
1039024671 8:33244746-33244768 GAGGGATCTCAGAATGAGCATGG - Intergenic
1040664250 8:49613023-49613045 TAGGGATTTCAGCAAGAGTGTGG + Intergenic
1040963198 8:53057322-53057344 TAGGGTTTTCATAAAGAAAATGG + Intergenic
1041445106 8:57942630-57942652 AAGGTTTGTTAGAAAGAGCATGG - Intergenic
1041899732 8:62968394-62968416 TAGGGTTTTCAGCAAAGACATGG + Intronic
1044077244 8:87837363-87837385 TATCATTTTCAGAAAAAGCATGG + Intergenic
1044755603 8:95458182-95458204 TAGAGTTTACAGAAAGAACATGG - Intergenic
1045270008 8:100653599-100653621 TAGAGCTTTCAGAGAGAGCACGG + Intronic
1045862173 8:106825823-106825845 CGGGGTATTTAGAAAGAGCAGGG + Intergenic
1046017809 8:108627141-108627163 TTGGGTTTTTAGAGAGAACAAGG + Intronic
1046019674 8:108649708-108649730 TAGGGTTTTCAGGGAGATAAAGG - Intronic
1046186005 8:110719465-110719487 TAGGGTTGTCAGATAAAGTACGG - Intergenic
1046259793 8:111752442-111752464 TAGGTGTGTCAGATAGAGCATGG + Intergenic
1046670298 8:117049656-117049678 TGGTGTTTTCAGAAGGAGAAGGG - Intronic
1047353349 8:124096807-124096829 AGGAGTTTGCAGAAAGAGCAAGG + Intronic
1047967069 8:130053556-130053578 TTGGGGTTTAACAAAGAGCATGG + Exonic
1048253148 8:132883923-132883945 TAGAGCTTTCAGAGGGAGCACGG - Intronic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1048897572 8:139006530-139006552 TAGAGTCTTCAGAGAGAGCAGGG - Intergenic
1049378777 8:142301784-142301806 CAGGGTTTTCAGGAAGATCGGGG - Intronic
1049894550 9:101243-101265 TAGCATCTTCAGAGAGAGCATGG + Intergenic
1050277695 9:4017086-4017108 TAGTGGTTTCTGAAAGAGAAAGG - Intronic
1050449042 9:5760285-5760307 TAAAGCTTTCAGAAAAAGCAAGG - Intronic
1051073944 9:13207530-13207552 TAAGCTATTGAGAAAGAGCATGG - Intronic
1052041683 9:23746440-23746462 GAGCGTTTTCAGAATGAGTAAGG + Intronic
1052643054 9:31194063-31194085 TAGGATTTCCATAAAGAGAAAGG - Intergenic
1053344318 9:37366851-37366873 TATGGTTTTTTGAAAGACCAGGG - Intergenic
1053505787 9:38642265-38642287 TTGGATTTTCAGAAAGATTAGGG - Intergenic
1053735756 9:41101233-41101255 TAGCATCTTCAGAGAGAGCATGG + Intergenic
1054692620 9:68330165-68330187 TAGCATCTTCAGAGAGAGCATGG - Intronic
1055218165 9:73893213-73893235 TTCAGTTTTCAGAAAAAGCAGGG - Intergenic
1055451584 9:76435848-76435870 TAGGGTTTTCACACAGTGAAGGG + Intronic
1057732414 9:97621912-97621934 TAGGGATTTCAAAAAGGGAAGGG - Intronic
1057885733 9:98828182-98828204 TAGGGTTGTCTGAAAGAGCTGGG + Intronic
1058377068 9:104334885-104334907 TAATGTTTTCAGGAAAAGCAGGG - Intergenic
1058930312 9:109712575-109712597 TATGGTTTGCAGAAAGATTAAGG + Intronic
1059532090 9:115044486-115044508 GAGGGCTTTCCAAAAGAGCAGGG + Intronic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1059762652 9:117353729-117353751 TGGGGTTTTCAGAAAGCAGATGG - Intronic
1059821225 9:117974407-117974429 TACAGTTTTGAGAATGAGCAAGG - Intergenic
1060075164 9:120584181-120584203 TAGGTTTGGCAGAAAGATCATGG - Intergenic
1060398692 9:123334507-123334529 GGGGGTTTGCAGAAATAGCAGGG + Intergenic
1061643007 9:131974499-131974521 TAGTGTTTTCAGAGTGAGAAGGG + Intronic
1062064015 9:134516522-134516544 TATAATTTTCAGAAAGAGCAGGG - Intergenic
1187404469 X:18990313-18990335 TAGGATTTGCGGAACGAGCAAGG + Exonic
1188693318 X:33157197-33157219 TAGAGTATTCAGTGAGAGCATGG - Intronic
1188946007 X:36303121-36303143 TACAGGTTTCAGAAGGAGCATGG - Intronic
1189236396 X:39490456-39490478 TAGAGTCTTCAGAGAGAGGATGG + Intergenic
1190372218 X:49753604-49753626 TAGAGATTTCAGAGGGAGCATGG + Intergenic
1190434124 X:50406712-50406734 TAGGGTCATCAGAGAAAGCATGG + Intronic
1190461830 X:50684384-50684406 TAGAGCCTTCAGAGAGAGCATGG + Intronic
1191818595 X:65276231-65276253 TGGGTGTTTCAGAAAGAGAAGGG + Intergenic
1192970604 X:76224954-76224976 TAGGGATCTGAGCAAGAGCAAGG - Intergenic
1194305867 X:92247562-92247584 TAGAGCTTTCAGAGGGAGCACGG - Intronic
1194603360 X:95950835-95950857 TTGTGTATTCAGCAAGAGCAGGG + Intergenic
1194979757 X:100428309-100428331 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1195588199 X:106591295-106591317 TAGAGCCTTCAGAGAGAGCATGG - Intergenic
1196075485 X:111571041-111571063 TAGGTTTTTCAGTAAAAACAAGG + Intergenic
1196150250 X:112365722-112365744 ATGGGATTACAGAAAGAGCACGG - Intergenic
1196693442 X:118585330-118585352 TAGAGCATTCAGAGAGAGCATGG - Intronic
1198409294 X:136349550-136349572 AAGGGTTCTCAGAAAGCCCATGG - Exonic
1199066759 X:143428359-143428381 TAAGGTCTTCAGAAAGTTCAAGG - Intergenic
1201892646 Y:18959348-18959370 TAGGGATTTCAAAAAGGGAAGGG - Intergenic
1201975446 Y:19843735-19843757 CACTGTTTACAGAAAGAGCATGG + Intergenic