ID: 1067975357

View in Genome Browser
Species Human (GRCh38)
Location 10:51018629-51018651
Sequence ATTCTGTCCTGAGTGATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067975357_1067975359 30 Left 1067975357 10:51018629-51018651 CCATTAATCACTCAGGACAGAAT 0: 1
1: 0
2: 1
3: 11
4: 162
Right 1067975359 10:51018682-51018704 AATATGTTTTTTAAAAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067975357 Original CRISPR ATTCTGTCCTGAGTGATTAA TGG (reversed) Intronic
903098358 1:21002785-21002807 ATTCTGTCCAGAGGGATAAGGGG + Exonic
911355209 1:96809029-96809051 ATTCTGTCTTAAGTTAATAAAGG - Intronic
915696695 1:157750298-157750320 ATTGTTTCCTGAGGTATTAATGG - Intronic
917176075 1:172236953-172236975 ATTCTCTCCTGTTTTATTAAGGG + Intronic
917751838 1:178060576-178060598 ATTCTGTCCTGAGTGTATTTAGG + Intergenic
921347764 1:214204563-214204585 ATTCTCTACTGATTGATTGAAGG - Intergenic
1062975307 10:1678419-1678441 TTACTGTCCTGAGTGCTGAAAGG - Intronic
1064002667 10:11676537-11676559 GTTCTAGCCTGAGTGATTAAGGG + Intergenic
1065440343 10:25747218-25747240 ATTTTGTTCTCAGTGACTAATGG + Intergenic
1066299917 10:34087463-34087485 ACTCTGTCCTAAGTGCTTTATGG - Intergenic
1066382080 10:34910578-34910600 ATTCAGCTCTGAGTGATGAAGGG - Intergenic
1067975357 10:51018629-51018651 ATTCTGTCCTGAGTGATTAATGG - Intronic
1068266913 10:54662220-54662242 ATTCTTTCCTCACTTATTAATGG - Intronic
1073677614 10:105666042-105666064 CTTCTGGCTTGAGTGATTCAAGG + Intergenic
1078941053 11:16006286-16006308 AATCAGTCTTGAATGATTAAAGG + Intronic
1080924604 11:36743238-36743260 ATTCTCTCATGAGTGAATAGGGG + Intergenic
1082258816 11:50062098-50062120 AGTTTGTAGTGAGTGATTAATGG - Intergenic
1086216346 11:84386716-84386738 ATTCTCTCATGAGTGATCCAAGG - Intronic
1086647500 11:89242644-89242666 ATTGTGTCAGGAGTGGTTAATGG + Intronic
1087668303 11:101075797-101075819 ATTGTTTCCTGAGTTTTTAATGG - Intronic
1088081954 11:105928700-105928722 ATTCTGCCTTGAGTGATAAAGGG + Intronic
1089629637 11:119776270-119776292 ATTCTGTTCTGAGTGACCCAAGG - Intergenic
1090080639 11:123609961-123609983 GTTCTGTCTTGAAGGATTAAGGG + Intronic
1091829155 12:3536936-3536958 ATGCTGTCCTTAGTGACAAAAGG - Intronic
1091898443 12:4123364-4123386 ATTCTTTCTTGAGTGATTGCAGG - Intergenic
1093986941 12:25544799-25544821 ATTCTTTCCTTTGTGATTCAAGG - Intronic
1095358282 12:41304077-41304099 ATTCTGTCTTGAGGGATATATGG + Intronic
1100669067 12:96789949-96789971 ATAGCCTCCTGAGTGATTAAAGG - Intronic
1108500521 13:51066025-51066047 ATTCTCTCCTGAGTGACTAGGGG - Intergenic
1109287477 13:60427376-60427398 ATTGTTTCCTGTGTTATTAAAGG + Intronic
1110247088 13:73338899-73338921 ATTTTGTCTTCAGTGATTCAAGG + Intergenic
1112681975 13:101777324-101777346 ATTCTGTCACTAGTGAGTAACGG + Intronic
1114875153 14:26707531-26707553 ATTCTGTTCTGACTGTTTACTGG - Intergenic
1115137800 14:30131930-30131952 ATTGTTTCCTGAGGAATTAATGG + Intronic
1120419410 14:84264328-84264350 ATTCATTCCTAAGTGATAAAGGG + Intergenic
1120906508 14:89625534-89625556 TTTCTTTCCTGAGTGGTTTAAGG - Intergenic
1121939926 14:98060578-98060600 ATTCTGTGCTGAGGAAATAATGG + Intergenic
1126217681 15:46175208-46175230 GTTCTATCCTGAGTAATTAGTGG + Intergenic
1131877177 15:96820956-96820978 ATTCAGTCCTGAGTTTGTAAAGG - Intergenic
1132086395 15:98911673-98911695 ATTCTTTAGTGAGTGATTAGAGG + Intronic
1132610859 16:815656-815678 ACTCTGGCCTGGGTGACTAAGGG - Intergenic
1133741292 16:8653524-8653546 ATTCTTTCATCAGTGATTAAAGG + Intergenic
1134236643 16:12471495-12471517 ATTCTGGCCTCAGTGAGAAATGG - Intronic
1137411322 16:48230618-48230640 ATTCTGTCCTGAGGGAATGTTGG + Intronic
1138108069 16:54301323-54301345 AACCTGTCATCAGTGATTAAAGG - Intergenic
1138936285 16:61728426-61728448 ATACTATCCTGAGGGATTAATGG + Intronic
1142455968 16:90223350-90223372 ATTCTGTCATCAGTGTTTTAGGG - Intergenic
1147543935 17:41383913-41383935 ATTCTGTGAAGAGTGATTATTGG - Intronic
1149957804 17:61072452-61072474 ATTCTGTACTAAGTAAGTAACGG - Intronic
1151876968 17:76872315-76872337 AGGCTGGCCTGAGTGATTGATGG + Intronic
1153717366 18:7863861-7863883 ATTGTTTCCTGAGTTTTTAATGG + Intronic
1155695533 18:28681028-28681050 CTTCTGTCTAGAGAGATTAATGG + Intergenic
1157237722 18:45980044-45980066 ATGCTGTCCTGATAGATTACTGG + Intergenic
1157844632 18:50991912-50991934 GTTCTGTCCTTACTGATTGATGG + Intronic
1158920991 18:62190677-62190699 ATTCTGTTCTAAGTGATCAGTGG - Intronic
1159327017 18:66935107-66935129 ATTCTGTACTGTGTGTTTAGAGG + Intergenic
1159904611 18:74078307-74078329 ATTCTTTCCTGAGGGTTTCAAGG + Intronic
1160880991 19:1320111-1320133 TGTCTGCCCTGAGTGATGAATGG - Intergenic
1162909346 19:13841033-13841055 ATTCTGTCCTCCATGAATAACGG - Intergenic
925054298 2:844653-844675 GATCTGAACTGAGTGATTAATGG + Intergenic
928792787 2:34978720-34978742 ATTCTTTCCTTAGAGTTTAAAGG - Intergenic
930330066 2:49971720-49971742 ATTCTATCCTTAGAAATTAATGG - Intronic
930962799 2:57281591-57281613 ATTTTGACCAGAGTGATAAAAGG - Intergenic
933312593 2:80679228-80679250 ATTCTGAACTGACTCATTAAGGG - Intergenic
935419015 2:102847430-102847452 ATTTTGTCCTCTCTGATTAAAGG - Intergenic
937621372 2:123991613-123991635 ATTCTGTGCTAAGTGATTTGTGG - Intergenic
938993445 2:136653292-136653314 ATTCTATTCTGTGTGATGAAGGG + Intergenic
942740263 2:179168085-179168107 ATTCAGTCCTGAGTTGTTCAAGG - Intronic
943545840 2:189276426-189276448 ATTGTGTCCTGTGAGGTTAAGGG + Intergenic
944039010 2:195333982-195334004 ATTTTGGCCTGAGAGCTTAATGG + Intergenic
944699758 2:202236501-202236523 ATTCTTTCATGAGTGTTCAATGG - Intronic
946336174 2:219038197-219038219 TTTCTTTCCTGAGTGACTCATGG + Intronic
949087466 2:242168151-242168173 ATTCTGTCATCAGTGTTTTAGGG - Intergenic
1170377197 20:15713001-15713023 TCTCAGTCCTGAGTCATTAAGGG + Intronic
1170430530 20:16272353-16272375 ATTAAGTCCTGAGTAATTTAAGG + Intronic
1171092252 20:22296388-22296410 ATTCTTTCCTGAGTCATAGAGGG - Intergenic
1171127780 20:22619455-22619477 ATTATTTGCTGAGTGAGTAATGG - Intergenic
1173352993 20:42262018-42262040 ATTCTGTGCTGCGTGTTTACTGG - Intronic
1174370600 20:50084833-50084855 AGTCTGACCTGAGAGATTACTGG + Intronic
1178202572 21:30424578-30424600 ATTCTGTCCTTAGAGATGCATGG + Intronic
1179245349 21:39628775-39628797 ATTATGACCTGAGTGCTTACTGG + Intronic
1182763555 22:32742325-32742347 ATTCTGGGCTGTGTGACTAAGGG - Intronic
1182915832 22:34029363-34029385 ATTCTGTCTTGAGAACTTAAAGG + Intergenic
1185358914 22:50393410-50393432 CTTCTGTCCTGAGTGAACACTGG - Intronic
1185412150 22:50688402-50688424 ATTCAGACCTGATTGATTCAGGG + Intergenic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
950568121 3:13783423-13783445 ATTAGGTCCTGAGGTATTAATGG - Intergenic
950669345 3:14516711-14516733 ATTCAGTCCTGATTCATTCATGG - Intronic
953780224 3:45862409-45862431 ATTTTGTCCTGTGTCATTATTGG - Intronic
954466178 3:50656338-50656360 ATTCTGTCCTGGGTGGTCAGTGG - Intergenic
955849039 3:63199695-63199717 ATTATTTCCTGACTGCTTAATGG + Intergenic
956839511 3:73124665-73124687 ATTCTGTCCTCAATGAATATGGG - Intergenic
957144405 3:76404902-76404924 ATTCTGTCTTGTTTGAATAATGG + Intronic
958909025 3:99972571-99972593 ATTCTTTCCAGAGTAAATAACGG + Intronic
959430534 3:106249972-106249994 AATGTGTACTGAGTGAGTAAAGG - Intergenic
959528662 3:107407363-107407385 ATTCTGTCCAGAGTCATTTTAGG - Intergenic
961942957 3:130656521-130656543 AGTGTGTGCTGATTGATTAATGG + Intronic
962513153 3:136122873-136122895 AATCTGTCATTAGCGATTAAAGG + Intronic
962897216 3:139726807-139726829 ATTCTTGCCTGAGTACTTAAAGG + Intergenic
962954319 3:140250187-140250209 AATGTGTCCTGAGGGATTATGGG + Intronic
963203282 3:142606297-142606319 GTTATGTCCTGAGGCATTAAGGG + Intronic
963493675 3:146033419-146033441 TTTCTGTCCTCTGTCATTAAGGG + Intergenic
964450843 3:156811386-156811408 GTTCTGTCTAAAGTGATTAAAGG + Intergenic
965351837 3:167621921-167621943 AGTCTCTCCTGTGTGATTAGTGG - Intronic
965909549 3:173754918-173754940 ACTCTGTGATGAGTGATTGAAGG - Intronic
967194886 3:187017513-187017535 AGTCTGTCCTGAGAGCTTCAAGG - Intronic
967728578 3:192884860-192884882 GTCCTTTCCTGAGTGATTCATGG - Intronic
969595401 4:8146303-8146325 AGTCTGTCCTGAGTGTACAATGG + Intronic
974696625 4:65384053-65384075 ATTCCTTCCTGACTCATTAATGG - Intronic
977630296 4:99235081-99235103 TTTCTGTGCTAAGTGATTAATGG + Intergenic
982519085 4:156390564-156390586 ATTCAGTCCTGCGTGACTATTGG - Intergenic
983938666 4:173520704-173520726 ATTGTGTCCTCAGTGACTGAAGG - Intergenic
984037350 4:174685828-174685850 ATTTTGTCTTCAGTGATTATAGG - Intronic
984907320 4:184640728-184640750 AATATGTACTGAGTGACTAATGG - Intronic
985909692 5:2869215-2869237 AGTCTGGCCTGAGTGATTCTGGG + Intergenic
986977281 5:13409344-13409366 ATTTTGACCAGAGTGACTAAAGG + Intergenic
987118160 5:14742708-14742730 ATGTTGTGCTGAGTGATTCAAGG - Intronic
987602389 5:20088395-20088417 AAACTGTCCTGAGAGATTACTGG - Intronic
988730739 5:33970298-33970320 AGTCTGTACTGACTGACTAAGGG - Intronic
989782516 5:45285550-45285572 ATTCAGCCCTGAGTTATTAAAGG + Intronic
991678926 5:69118515-69118537 ATTCTGTCTGGATTTATTAATGG + Exonic
995888377 5:116921466-116921488 ATTTTGTCCTCAGTGATTTTGGG + Intergenic
995990596 5:118234348-118234370 TTTCTGTCCTGGATGGTTAAGGG - Intergenic
1001497136 5:172196705-172196727 TTTCTGTCATCAGTGAGTAAGGG + Intronic
1004366547 6:15018039-15018061 TTTCTGTCCTGAGTCAAAAAAGG - Intergenic
1005125506 6:22442403-22442425 ATTCTGTCTTCTGTGATTGAAGG + Intergenic
1006922646 6:37636745-37636767 ATTCTGTCCAGAGTGAGCACTGG - Exonic
1007241459 6:40429222-40429244 ATTCCCACCTGAGTGATTACAGG + Intronic
1007978612 6:46127791-46127813 ATTCTGTCCAAAGTGATTAAAGG + Intergenic
1011274498 6:85616650-85616672 ATTTTATCCTGAATTATTAAAGG + Intronic
1011562445 6:88634558-88634580 AGTCTGCCCTGAGTGTATAAAGG + Intronic
1011996138 6:93590447-93590469 ATTCTGTCCATACTGCTTAAAGG + Intergenic
1013332859 6:109123095-109123117 ATTCTTACCTAAGTGATTGAAGG + Intronic
1013922482 6:115424453-115424475 ACTCTGTCCTCAGTTATAAAAGG + Intergenic
1014236851 6:118967559-118967581 ATTCTGTCCTGAATGATATGAGG + Intronic
1015079987 6:129211928-129211950 ATTCTTTGTTGAGTGAATAAAGG + Intronic
1021608556 7:22433742-22433764 ATTCTTTCCTGAATGAGTAGTGG - Intronic
1024949652 7:54846382-54846404 ATTTTGTCATGAGTGATTGAGGG - Intergenic
1030378696 7:108785831-108785853 ATTCCTTCCTGAGTGATGATTGG + Intergenic
1030480218 7:110093973-110093995 ATTGTTTTCTGATTGATTAATGG - Intergenic
1030501486 7:110364705-110364727 ATTTTGACCAGAGTGACTAAAGG - Intergenic
1034525866 7:151661828-151661850 ACTTTCTCCTGAGTCATTAAGGG + Intronic
1035119420 7:156553551-156553573 ATTCTGTCCAAATTGATGAATGG + Intergenic
1035281425 7:157780841-157780863 ATTCTGTCCTGATTGATCTGTGG - Intronic
1035497261 8:63189-63211 ATTCTGTCATCAGTGTTTTAGGG + Intergenic
1035760223 8:2063583-2063605 ATTCTTTGCTGAGTGATTTTAGG + Intronic
1035771196 8:2148236-2148258 ATTCTGCCCTGAGGGAGTAGGGG - Intronic
1035853661 8:2948405-2948427 ATTTTTGCCTTAGTGATTAAAGG - Intronic
1036968668 8:13329412-13329434 ATTCTGGCCTGTGGGATAAATGG + Intronic
1039408060 8:37329525-37329547 ATTCTGCCGTGAGTGACTAATGG - Intergenic
1039577346 8:38634003-38634025 CTTCAGGCCTGAGTCATTAAGGG + Intergenic
1039815714 8:41092835-41092857 ATGCTATCCTGAGTGGTTCATGG + Intergenic
1041342160 8:56857360-56857382 ATTGTGTCTTGAGTAATTTAAGG + Intergenic
1046231379 8:111363454-111363476 ATTCATTCCTCATTGATTAAAGG + Intergenic
1046688346 8:117253137-117253159 ATTTTGTCCTGAATGACTATTGG + Intergenic
1047162898 8:122400884-122400906 ATTCTGTCTTAAGTGGTTCACGG + Intergenic
1048641281 8:136364996-136365018 ATTCTTTCCTGTTTGATTCATGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049482513 8:142833467-142833489 TTTCTATCCTGAGTGCTGAATGG - Intergenic
1049483200 8:142837554-142837576 TTTCTATCCTGAGTGCTGAATGG + Intronic
1050848118 9:10249215-10249237 ATCTTGTCTTTAGTGATTAATGG - Intronic
1051790311 9:20794835-20794857 ATTCTGTCTTTTGTGAGTAATGG + Intronic
1052228329 9:26116842-26116864 ATTCTGTCTTCAGTGCTGAATGG - Exonic
1055607021 9:77981253-77981275 TTTTTGTCTTGATTGATTAAAGG - Intronic
1057787300 9:98096611-98096633 TTTCTGGCCTGAGAGATGAAGGG - Intronic
1058039138 9:100284810-100284832 ATTCTATCTTGATTGATTTATGG + Intronic
1058433661 9:104941920-104941942 ATTATGTCCTGATAGATTGATGG - Intergenic
1187597938 X:20795691-20795713 ATGCTTACCTGAGTGATTAAGGG - Intergenic
1188516739 X:30995499-30995521 AATCTGTTCTGAGTGGTGAAAGG - Intergenic
1190964965 X:55290848-55290870 ATCCACTCCTGAATGATTAATGG - Intergenic
1194020029 X:88677063-88677085 ATTCTGTCTTGAATAAATAACGG - Intergenic
1195694466 X:107656453-107656475 TTTCTGGCCTGAGTGACTGATGG + Intergenic
1199802100 X:151261835-151261857 TTTCTGTGCTAAGAGATTAATGG + Intergenic
1199804299 X:151282463-151282485 TTTCTGTGCTAAGTGATTAATGG - Intergenic
1200313322 X:155102505-155102527 ATTATGTCATCTGTGATTAAAGG + Intronic