ID: 1067978937

View in Genome Browser
Species Human (GRCh38)
Location 10:51060065-51060087
Sequence CAGTGTTACTAGAGTTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067978937_1067978938 28 Left 1067978937 10:51060065-51060087 CCTTTTTAACTCTAGTAACACTG 0: 1
1: 0
2: 2
3: 24
4: 234
Right 1067978938 10:51060116-51060138 GAGCTATATCAACTTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067978937 Original CRISPR CAGTGTTACTAGAGTTAAAA AGG (reversed) Intronic
901766607 1:11503828-11503850 CAGTGTTCCTATCGTTAAAATGG + Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905061453 1:35143125-35143147 CAGAGTCACTAGATTTAAAGGGG + Intergenic
906817581 1:48894987-48895009 CAGTGTTTCACTAGTTAAAAGGG + Intronic
910878464 1:91900479-91900501 AAGTGTTACTGTTGTTAAAACGG - Intronic
910954135 1:92682930-92682952 AAGTGTAAATATAGTTAAAAAGG + Intronic
913248335 1:116890123-116890145 CAGTGTTACAAGTGTTCATATGG + Intergenic
916102588 1:161405929-161405951 CAGAGTCACTAGATTTAAAGGGG + Intergenic
916271821 1:162951655-162951677 CAGAGATACTTGAGTTAAAAAGG - Intergenic
918028486 1:180778585-180778607 TAGTGTTACTAGAGTCTAATGGG - Intronic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
919062381 1:192649748-192649770 CAGAGTAACTAGAGATGAAAAGG - Intronic
923083094 1:230678785-230678807 CACAGTTTCTAGAGTTAACAAGG - Intronic
923749134 1:236730751-236730773 GAGTGTTACTAGTGTTACAAAGG - Intronic
1064912299 10:20415985-20416007 AGGTTTTACTAAAGTTAAAAGGG + Intergenic
1065552175 10:26878867-26878889 AAGTGCTACTATAATTAAAATGG + Intergenic
1067978937 10:51060065-51060087 CAGTGTTACTAGAGTTAAAAAGG - Intronic
1068392223 10:56413263-56413285 AAGTGTTACTGGCCTTAAAAAGG - Intergenic
1068442815 10:57080845-57080867 CAGTGCTAATAGAGTAAAAGAGG - Intergenic
1068881903 10:62058660-62058682 CAGTGATACAACAGATAAAAGGG - Intronic
1070032362 10:72689657-72689679 CAGAGATACTACATTTAAAAAGG - Intergenic
1070071920 10:73098085-73098107 TATTGTTATTAGAGTGAAAAAGG - Intergenic
1070760254 10:79019795-79019817 CAGTTTGGCTAGAATTAAAAGGG - Intergenic
1072042723 10:91624803-91624825 CAGTGTTCCTATCTTTAAAATGG - Intergenic
1073803796 10:107072974-107072996 CAGGGTTACTAGAGTTCACTGGG + Intronic
1074754464 10:116614173-116614195 CAGTGCTAATAAAGTTAAAATGG - Intergenic
1078474159 11:11616681-11616703 CAGTGGTACTAGAGACAAATAGG - Intronic
1078922101 11:15840456-15840478 CAGTGTTAGGAGAGTTAAAATGG + Intergenic
1079009777 11:16818381-16818403 CAGTGTTATAAGAGTAAGAAGGG - Intronic
1079772865 11:24485776-24485798 CAATGTTACTTGTGATAAAAAGG - Intergenic
1080554749 11:33406120-33406142 TTGTGTTACTAGAGTAAAAAAGG - Intergenic
1080824459 11:35836213-35836235 AAGTATTCCTAGAGCTAAAAAGG + Intergenic
1084352600 11:68613405-68613427 TAGTAATACTATAGTTAAAATGG + Exonic
1084390329 11:68871424-68871446 CAGCGTCACTAGATTTAAAAGGG - Intergenic
1084585105 11:70055424-70055446 AAATTTTACTAGAGATAAAAAGG - Intergenic
1085434660 11:76489496-76489518 AAGGGTTACCAGAGATAAAAAGG - Intronic
1086326319 11:85704269-85704291 AAGCATTACTAGAGATAAAAAGG + Intronic
1087366890 11:97231555-97231577 GAGTTTTGCTAGAGTTAAATAGG + Intergenic
1087586920 11:100133491-100133513 CTGTGTTGCTAGAGATAAACAGG - Intronic
1092587632 12:9916153-9916175 AAGTGTTTCTTGGGTTAAAATGG - Intronic
1093407688 12:18825100-18825122 CATTTTTACTAGAGCTAAGATGG + Intergenic
1093504276 12:19846727-19846749 CAGCCTTACTAAAGATAAAATGG + Intergenic
1093957891 12:25243009-25243031 CAGTTTTTCTACATTTAAAATGG - Intronic
1095735510 12:45552211-45552233 CAGTGGTAGTAGAGTAGAAAGGG - Intergenic
1097713255 12:62937837-62937859 CTGTGTTACTAAATTCAAAAGGG + Intergenic
1098307210 12:69114249-69114271 CAGTGTTTCTAAACTTTAAATGG + Intergenic
1099070325 12:78037883-78037905 AAGTGTTACTACAATAAAAAGGG - Intronic
1099141520 12:78982374-78982396 TAGAATTTCTAGAGTTAAAAGGG - Intronic
1099327978 12:81243758-81243780 CAGTGATACAAGAGCTACAAGGG - Intronic
1100251074 12:92824521-92824543 GAGTGTTAGAAGAGTTAAAAAGG - Intronic
1100864610 12:98843642-98843664 CAGTGTGACTACAGTTTAATCGG + Intronic
1101168958 12:102068176-102068198 CTTTGTTTCTAGAGTTTAAAAGG + Intergenic
1103422959 12:120804250-120804272 AACTGTTACTAGAGATAAAGAGG + Intronic
1103657808 12:122487482-122487504 CAGTATTACTGGAGTCAAATAGG - Intronic
1104622160 12:130323758-130323780 GAGGCTTACTATAGTTAAAATGG - Intergenic
1105665156 13:22547056-22547078 AAGTGTTAGTAGAGATAAAGGGG - Intergenic
1105842832 13:24270080-24270102 CATTGTTCATAAAGTTAAAAAGG + Intronic
1106260504 13:28062385-28062407 CAGTGGTAATCAAGTTAAAATGG + Intronic
1106939075 13:34756518-34756540 AAATGTTTCTAGAGTTAAAACGG + Intergenic
1107419245 13:40231257-40231279 CAGTTTTACTAGATTTGAAGGGG + Intergenic
1108309546 13:49173784-49173806 TTGTGTTGCTAGAGATAAAATGG - Intronic
1108584477 13:51857991-51858013 AAGTATTACTAAAGATAAAACGG + Intergenic
1108985964 13:56587855-56587877 CAGTGTTAGTAGGGTGGAAAAGG + Intergenic
1109496605 13:63180069-63180091 CAGAGGTAGTAGAGTTAACAAGG - Intergenic
1110033038 13:70642008-70642030 AAGTGTTATTAAAGTTAAAGAGG + Intergenic
1111506241 13:89193249-89193271 GAGTGTTACTAGAGATAAAGGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112267255 13:97936039-97936061 CTGTGTTATTTGAGGTAAAAGGG + Intergenic
1112870074 13:103960477-103960499 TAGTGTTACTAAAGTCAAAGGGG - Intergenic
1114369669 14:22072126-22072148 AAATGTTACTAGAGATAAAAAGG - Intergenic
1117709929 14:58517164-58517186 CAGTGTTAAGAGAATGAAAAAGG + Intronic
1120408101 14:84114979-84115001 AAGTTTTACTAGAGATAAAGAGG + Intergenic
1120938796 14:89925396-89925418 CAGTTTTATTAGTGTTAAAGAGG + Intronic
1122562065 14:102622925-102622947 AAGCATTACTAGAGTTAAAGAGG - Intronic
1126674032 15:51143469-51143491 AAGCATTACTAGAGATAAAAAGG - Intergenic
1127095260 15:55506486-55506508 GAGTGTTACTAGAATTAAGAGGG - Intronic
1127255225 15:57285142-57285164 CAATGCTACTAGAATCAAAATGG + Intronic
1128959198 15:71982914-71982936 AAGCATTACTAGAGATAAAAAGG - Intronic
1130315771 15:82795053-82795075 AAGTGTTAGTAGAGATAAAGAGG - Intronic
1130740914 15:86599184-86599206 CAGAGTTACAAAAGTTACAAAGG + Intronic
1133911634 16:10071485-10071507 CAGTGTTATTAGGGTGAAGAAGG - Intronic
1135569063 16:23534461-23534483 CAGTATGACTAGAATTAATATGG - Intronic
1136155894 16:28381888-28381910 AAGTGTTAATATGGTTAAAATGG - Intronic
1136207191 16:28733401-28733423 AAGTGTTAATATGGTTAAAATGG + Intronic
1138258279 16:55589947-55589969 GAGTATTACTAGAATTAAAGAGG - Intergenic
1139408363 16:66737939-66737961 CAGTCTTACTGGACTTAGAAGGG - Intronic
1140285106 16:73595563-73595585 GAGTGTGAATAGAGTCAAAATGG - Intergenic
1142490842 17:278430-278452 CAGTGTGACTTGAGTTAAGTTGG - Intronic
1146042275 17:29467716-29467738 CAGTACTATTAGAGTTAAATGGG - Intronic
1151936884 17:77267405-77267427 CAGTGTTATTATACTTTAAAGGG - Intergenic
1152746170 17:82040340-82040362 CACTTTTCCTAGAGTCAAAACGG + Intergenic
1153950038 18:10050778-10050800 CAGTGGTCCTAGAGATAACATGG + Intergenic
1155384669 18:25264427-25264449 CAGTGAAACAAGAATTAAAATGG - Intronic
1159559309 18:69976830-69976852 CAATGTTCCTAGAAGTAAAATGG - Intergenic
1161628979 19:5341937-5341959 TAGTGTAACTAGAATAAAAACGG - Intergenic
1164148560 19:22528936-22528958 CAGAGTTACTAGGTTTAAAGGGG - Intronic
1164665283 19:30028029-30028051 AAATGTTACTAGAGAAAAAAGGG - Intergenic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1167770649 19:51513953-51513975 AAGTGTTAATGGAGATAAAAGGG - Intergenic
925530622 2:4857199-4857221 GAATGTTTCTAGAGTTAAAGCGG - Intergenic
926437253 2:12850755-12850777 TAATGTAACTGGAGTTAAAAGGG - Intergenic
928056632 2:28062641-28062663 CAATGATACTTGTGTTAAAAAGG + Intronic
928467843 2:31539594-31539616 CAGTGTTAGTAGAGACAACATGG + Intronic
928585054 2:32751427-32751449 AAGTGCTACTACAGTAAAAAGGG - Intronic
931110122 2:59101269-59101291 CAGTGTGGCTAGAGTAAAACAGG - Intergenic
933309574 2:80643654-80643676 CAGTCTTGCTAGTTTTAAAATGG - Intronic
933830862 2:86207339-86207361 CACTGTTACTAAATTGAAAAAGG + Intronic
935075250 2:99736355-99736377 AAGCATTACTACAGTTAAAAAGG - Intronic
935382787 2:102469841-102469863 AAATGTTACTAGAGATAAAGAGG - Intergenic
935831267 2:107002988-107003010 CAGTGTTAATAAAGTTACATTGG - Intergenic
936613829 2:114028126-114028148 CTGTGTTTCTAGAGTTTGAAGGG - Intergenic
936990600 2:118360910-118360932 AAGTCTTACTAAACTTAAAAAGG - Intergenic
937169017 2:119846390-119846412 AAATGTTACTAGAGTCAAAGAGG - Intronic
937190727 2:120095251-120095273 AAAAGTTACTAGAGATAAAAAGG - Intronic
937941367 2:127288635-127288657 AAGTGGTACCAGAGTTAAGAAGG - Intronic
939396686 2:141639608-141639630 CATTGTTATTATATTTAAAAAGG - Intronic
939556484 2:143680404-143680426 TAGGGTTACTAGAGATTAAAAGG - Intronic
942686153 2:178534224-178534246 GAGTGTTGCTAAAGTTAAAGTGG - Exonic
943260435 2:185653248-185653270 GAGTGTTACTAGAGATAAAGAGG + Intergenic
945243712 2:207699245-207699267 CAGAGGTAATACAGTTAAAATGG - Intergenic
945344109 2:208692647-208692669 CAGTGTTTCTAGAGTTGGGAAGG - Intronic
1169174975 20:3502979-3503001 CAGTATCACTGGAGTGAAAAAGG - Intronic
1169337271 20:4766544-4766566 CAGTCTAACTAAAGTTAAACTGG - Intergenic
1169835856 20:9877860-9877882 AAATGTTACTGGAGATAAAAAGG + Intergenic
1172075562 20:32293708-32293730 TACTGCTACTTGAGTTAAAAAGG + Intronic
1175674107 20:60932177-60932199 CGGGGTTATGAGAGTTAAAAAGG + Intergenic
1178379977 21:32099692-32099714 CAGTCTTACTAGGGTTCAACAGG + Intergenic
1179224656 21:39443038-39443060 CAGTGTTTGTAGAGTGAAATGGG + Intronic
1179832942 21:44009734-44009756 CAGTGTTAATGGCATTAAAAAGG + Intergenic
1181677893 22:24469187-24469209 CTATGTTGCTAGGGTTAAAATGG + Intergenic
1185240843 22:49745065-49745087 AAGTGTTACTAGGGATAAAGAGG - Intergenic
1185412485 22:50691898-50691920 CAGTGTTACAGAAGTTAAAAAGG - Intergenic
949815137 3:8050101-8050123 CAGTGTTCCTATATGTAAAATGG - Intergenic
949992227 3:9588927-9588949 CACTGTTAATAGAGTGAAAAGGG - Intergenic
950058798 3:10051520-10051542 CAGTGTTAATTGAATTATAAGGG + Intronic
951101048 3:18689354-18689376 AAGTATTACTAGATATAAAAAGG - Intergenic
952811723 3:37410359-37410381 CAGAAATTCTAGAGTTAAAAAGG - Intronic
955309437 3:57870229-57870251 AAGTGTTACCATAGCTAAAATGG + Intronic
957150434 3:76479299-76479321 CATTTTTACTAGTTTTAAAATGG + Intronic
962684712 3:137836273-137836295 TAGTGTCACAAGAGTTAAAGGGG - Intergenic
963165453 3:142197368-142197390 ACATGTTACTAGAGATAAAAAGG - Intronic
963291057 3:143489716-143489738 CAGTGTAAACAGAGTAAAAAAGG + Intronic
963334421 3:143956540-143956562 CAGTGTTACAAGTGTAACAAGGG + Intergenic
963893132 3:150658180-150658202 CAGTGATATAAGAGTTAAAAAGG + Intergenic
964496941 3:157301597-157301619 CAGTTTTAATAGAGTTTTAAGGG - Intronic
964699492 3:159549240-159549262 CAGAGTTACTAGAAATTAAATGG - Intronic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
966275286 3:178158393-178158415 AAATATTACTAGAGATAAAAAGG + Intergenic
966276383 3:178175969-178175991 AAGTATTACTAGAGATAAAGAGG + Intergenic
969647211 4:8438658-8438680 CAGAGTCACTAGATTTAAAGGGG - Intronic
970915298 4:21326231-21326253 AACTGTTATTAGAGCTAAAATGG - Intronic
971752865 4:30673958-30673980 TAATGTTACTTGAGTAAAAAAGG - Intergenic
972429565 4:38967693-38967715 AAGTGTTACTTGAATTAGAATGG + Intronic
972893836 4:43594061-43594083 CAGTGTTAGTTGAGTTCAAAGGG - Intergenic
973134255 4:46686384-46686406 CAGTGTGACAAGAGTTCAATGGG - Intergenic
974289367 4:59911088-59911110 CAGTGTTCCTAGAAGTGAAATGG + Intergenic
974520757 4:62977298-62977320 AAGATTTACTAGAGTGAAAACGG - Intergenic
975373707 4:73617909-73617931 CACGGTTACTAGAGTTACATGGG - Intronic
977516691 4:98029430-98029452 GAGTATTACTAGAGATAAAGAGG - Intronic
979103236 4:116650019-116650041 CAGTGAGACTAGATTTAGAAAGG - Intergenic
979208149 4:118067253-118067275 CAATCACACTAGAGTTAAAATGG - Intronic
982915012 4:161197029-161197051 CACTGTTATTAGCGTTAAATGGG - Intergenic
984150224 4:176120926-176120948 TAATGTTTCTAAAGTTAAAAAGG + Intronic
984154029 4:176172329-176172351 CAATGTTACTAAAATTCAAACGG - Intronic
986600089 5:9464580-9464602 CAGTCAAATTAGAGTTAAAATGG + Intronic
986922491 5:12704520-12704542 CAGTGTCACCAAAGTTAAACAGG + Intergenic
987633123 5:20502799-20502821 CAGGGTTACTACATTTATAAAGG + Intronic
988042386 5:25906035-25906057 CAGTGATAATCAAGTTAAAATGG - Intergenic
989214358 5:38888525-38888547 TAGTGTTATAGGAGTTAAAAGGG - Intronic
989271583 5:39539738-39539760 CAGAGTTATTAGCATTAAAAAGG - Intergenic
989759894 5:45001251-45001273 GATTGTTACAAGAGTGAAAAGGG - Intergenic
990662444 5:58031698-58031720 CAGTTTTACCAGAGATAAAGTGG + Intergenic
990822917 5:59862853-59862875 CTGTGTTATTGGAATTAAAAGGG + Intronic
991262249 5:64679691-64679713 CAGTGTTAGTGGAATTAGAAAGG + Intergenic
992069733 5:73137570-73137592 CAGTGATATAGGAGTTAAAAAGG - Intergenic
992500979 5:77343493-77343515 CAGTATAAAAAGAGTTAAAATGG + Intronic
992584682 5:78224742-78224764 AAATGTTACTAGAGATAAAGAGG + Intronic
994092833 5:95823991-95824013 CATCGTTACTAGAATTAAAATGG + Intronic
994258205 5:97625962-97625984 CTGTATTACTAGAGCTAAATAGG + Intergenic
996140289 5:119899045-119899067 GAGTATTACTAGAGATAAAGAGG - Intergenic
996809825 5:127504439-127504461 CAGTATTAATAAAATTAAAAAGG + Intergenic
997637272 5:135422093-135422115 AAGCATTACTAGAGATAAAAAGG - Intergenic
998330830 5:141325298-141325320 AAGTGTTACAAGAGGAAAAAGGG + Intergenic
998486951 5:142511363-142511385 CTGTTTTACTAAAGCTAAAATGG - Intergenic
998667927 5:144319769-144319791 CTGTGTTGCTTGAGTAAAAATGG + Intronic
999581065 5:153038497-153038519 CATTGTGCTTAGAGTTAAAATGG + Intergenic
999757985 5:154679525-154679547 CAGTGTTCCTAGTGTTTACAGGG - Intergenic
1000278148 5:159757730-159757752 CAGTTTTCCTAGAGTGAGAAGGG - Intergenic
1000669866 5:164047617-164047639 CAGTGTGACAAGAGTAATAATGG - Intergenic
1000904304 5:166945066-166945088 CAGAATTACTAGAGATAAAGAGG + Intergenic
1004052628 6:12101984-12102006 AAATGTTACTAGAGGTAAAGAGG + Intronic
1004832523 6:19492659-19492681 CAGTGTTAAAAAAATTAAAATGG + Intergenic
1004967053 6:20864284-20864306 TTGTGTTTCTAGACTTAAAATGG + Intronic
1005421478 6:25655784-25655806 CACTGTTCCTAGAGGAAAAAAGG - Intronic
1005440123 6:25858338-25858360 CAGTGTTTTGAGAGTGAAAATGG - Intronic
1007018354 6:38492418-38492440 CAGTGTTTATAAAGTTCAAATGG + Intronic
1008341715 6:50373515-50373537 AAATGTTACTAGAGATAAACAGG - Intergenic
1008583315 6:52925817-52925839 CAGAGTTACTAGATTTAAAGGGG - Intergenic
1008934179 6:56971907-56971929 CACTATTAACAGAGTTAAAAAGG - Intronic
1009548845 6:65059749-65059771 CAGTGTGACTAAACTTAAACAGG - Intronic
1010867253 6:80993164-80993186 AAGTATTACTAGAGATGAAAGGG + Intergenic
1014307619 6:119761536-119761558 CAATCTTATTAGAGTTAGAATGG - Intergenic
1014484886 6:121985807-121985829 CAGTGATAATATACTTAAAATGG + Intergenic
1015037690 6:128677097-128677119 CAGTGTTCTTATATTTAAAATGG + Intergenic
1016184920 6:141186436-141186458 CAGGGTGACTACAGATAAAAAGG + Intergenic
1016242700 6:141950751-141950773 CAGTGTTACTACTATTACAATGG - Intergenic
1016261684 6:142178975-142178997 ATGTGTTACTAGAAATAAAAGGG + Intronic
1018984667 6:168627193-168627215 CAGTCTTACTAGAGGAGAAATGG - Intronic
1019862530 7:3673331-3673353 CAGTGTCAATAGAGACAAAAGGG + Intronic
1020624854 7:10565438-10565460 AAGTGGTACTAGAGATAAACAGG + Intergenic
1021348832 7:19563296-19563318 AAGTGTCAGAAGAGTTAAAATGG - Intergenic
1021923731 7:25514220-25514242 CACTCTTAAAAGAGTTAAAATGG + Intergenic
1022827174 7:34026621-34026643 CAGAGTTACTAAAATGAAAATGG + Intronic
1022905796 7:34854548-34854570 AAGTATTAGTAGAGTTAAACAGG + Intronic
1026249350 7:68654713-68654735 AAATGCTACTAGAGATAAAAAGG + Intergenic
1028871356 7:95773887-95773909 CAGTGTTAGTAAATTTGAAAAGG + Intronic
1032232671 7:130088953-130088975 AAGTTTTACTGGAGATAAAAAGG + Intronic
1032369775 7:131336201-131336223 AAGTGTTACTAGAGATAAAAAGG - Intronic
1032738212 7:134712145-134712167 CATTGTTTCAAGAATTAAAAAGG - Intergenic
1035088402 7:156281786-156281808 AAGTGTTACTAGAGATAAACAGG - Intergenic
1038157375 8:25002475-25002497 CAGAGTTGTGAGAGTTAAAAGGG - Intergenic
1038341174 8:26686460-26686482 CAGGGTGACTATAGTTAATAAGG - Intergenic
1039287468 8:36058038-36058060 AAGTGTTACTAGAAAGAAAAGGG + Intergenic
1044823774 8:96177521-96177543 CTGTGTCACTAGAGAGAAAAAGG - Intergenic
1045340251 8:101247597-101247619 GTGTGTTACTAGAATTAAACAGG + Intergenic
1047359462 8:124154267-124154289 GAGTATTACTAGAGATAAAGGGG + Intergenic
1050099611 9:2104998-2105020 CAGTATTACTATTGTTAAATGGG + Intronic
1050833743 9:10049560-10049582 CATTGTTAATAAAGTTATAAGGG + Intronic
1051303887 9:15686647-15686669 AAATGTTACTAGAGATAAAGAGG + Intronic
1052344292 9:27392979-27393001 AAGTGTTGCTTGAGATAAAAAGG + Intronic
1053529676 9:38867759-38867781 CAGTTTTACAAGAGATGAAAAGG + Intergenic
1054201901 9:62092186-62092208 CAGTTTTACAAGAGATGAAAAGG + Intergenic
1054814229 9:69459525-69459547 AAGTATTACTGGAGATAAAAAGG - Intronic
1054859906 9:69939888-69939910 AAGTGTTACTAGAGATAAAGAGG + Intergenic
1055945981 9:81690869-81690891 AAGTGGAACTTGAGTTAAAAGGG + Intergenic
1056716038 9:89030116-89030138 AAATGTTACTAGAGATAAAGGGG + Intronic
1056760957 9:89414700-89414722 CAGTTTTCCTAGAATTAAAATGG + Intronic
1057347474 9:94263338-94263360 AAGTGTTACCAGAGATACAAAGG - Intronic
1057368252 9:94444680-94444702 CAGAGCTACAAGAGTAAAAAAGG - Intronic
1058200951 9:102039932-102039954 CAGTGATGCTAAAGTAAAAACGG - Intergenic
1058489135 9:105477133-105477155 AAGTGTTACTAAATTTAATAAGG - Intronic
1059114316 9:111587118-111587140 CTGTGTTAATAGAGTGGAAAAGG - Intronic
1059724981 9:116998915-116998937 CTGTGTTACTAAAGTTTAAAGGG - Intronic
1062202426 9:135310629-135310651 AAGTGTTACTGGAGATAAAAAGG + Intergenic
1187996040 X:24927500-24927522 GAGTGTTACCAGAGTAATAAGGG - Intronic
1188281896 X:28280678-28280700 CAATATGAATAGAGTTAAAATGG - Intergenic
1188536526 X:31202694-31202716 CATTGTTAATAGAATTAGAATGG + Intronic
1189512559 X:41677672-41677694 CAGTCTTACTGTAGTAAAAATGG + Intronic
1190874493 X:54449934-54449956 CAGTGTTACAAGTGTAAAATGGG + Intronic
1191865474 X:65700248-65700270 CAGTTTTCCTACAGGTAAAATGG - Intronic
1191921640 X:66262957-66262979 CAAAGTTATTGGAGTTAAAAGGG + Intronic
1194444319 X:93968898-93968920 TAGGGTGACTATAGTTAAAAAGG + Intergenic
1195628706 X:107031235-107031257 TGGAGTTACTAGATTTAAAATGG - Intergenic
1196286701 X:113890247-113890269 AAGGTTTACTAGAGATAAAAGGG - Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1196927129 X:120644670-120644692 CAAGGTTACTATAGTTAATAAGG + Intergenic
1197542215 X:127778382-127778404 CAGTGTTACTGGGTTTAAAGTGG + Intergenic
1198325642 X:135569760-135569782 GAGAATTTCTAGAGTTAAAAAGG - Intronic
1198469445 X:136932619-136932641 CAGAGTCACTAGATTTAAAGCGG + Intergenic
1198609511 X:138382530-138382552 CATTTTTCCTATAGTTAAAATGG + Intergenic
1198690569 X:139279698-139279720 GATTGTTACAAGAATTAAAAAGG + Intergenic