ID: 1067989875

View in Genome Browser
Species Human (GRCh38)
Location 10:51199818-51199840
Sequence AGCTCTGCTGTTACACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067989871_1067989875 8 Left 1067989871 10:51199787-51199809 CCCTTTGACGCTTTGGGCTAGGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1067989875 10:51199818-51199840 AGCTCTGCTGTTACACATCCTGG No data
1067989873_1067989875 7 Left 1067989873 10:51199788-51199810 CCTTTGACGCTTTGGGCTAGGGC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1067989875 10:51199818-51199840 AGCTCTGCTGTTACACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067989875 Original CRISPR AGCTCTGCTGTTACACATCC TGG Intronic
No off target data available for this crispr