ID: 1067990466

View in Genome Browser
Species Human (GRCh38)
Location 10:51206032-51206054
Sequence TGTTTTAAACAGAAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067990464_1067990466 14 Left 1067990464 10:51205995-51206017 CCTGTAATGAAATTACATTCATA 0: 1
1: 0
2: 1
3: 17
4: 299
Right 1067990466 10:51206032-51206054 TGTTTTAAACAGAAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067990466 Original CRISPR TGTTTTAAACAGAAGCAGCA GGG Intronic
No off target data available for this crispr