ID: 1067992804

View in Genome Browser
Species Human (GRCh38)
Location 10:51234523-51234545
Sequence TGTTTGGTAAGAAAACCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067992804_1067992807 17 Left 1067992804 10:51234523-51234545 CCTTTAGGTTTTCTTACCAAACA 0: 1
1: 0
2: 1
3: 34
4: 267
Right 1067992807 10:51234563-51234585 ATTAATACATAGCATTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067992804 Original CRISPR TGTTTGGTAAGAAAACCTAA AGG (reversed) Intronic
903635498 1:24811814-24811836 TCTTTGGTAAGAATACTTCATGG + Intronic
903898112 1:26621803-26621825 TGTTTGGTCAGAAAGCTTGAGGG - Intergenic
905266102 1:36755376-36755398 GGTTTGGTAAAGAAAACTAATGG + Intergenic
907521475 1:55026182-55026204 TGTTTGGACAGAAAGCCTACAGG - Intergenic
907889371 1:58622938-58622960 TTTTTGTTAAGAAAATTTAATGG - Intergenic
908656735 1:66396022-66396044 TTGTTGGTGAGAAAACTTAAAGG + Intergenic
908852623 1:68389851-68389873 TGTTTGGACAGAAAGCCTACAGG - Intergenic
908952266 1:69575780-69575802 TTTTTGGTGAGAAAACTTATTGG - Intronic
909223446 1:72989938-72989960 TGTTTGGACAGAAAGCCTACAGG + Intergenic
909869734 1:80723779-80723801 AGTTTGGTCAGAAAATTTAAGGG + Intergenic
910497892 1:87853259-87853281 TCTTAGGAAAGAAAGCCTAATGG + Intergenic
912093048 1:106105996-106106018 TGGTTAGTAAGATAAACTAATGG - Intergenic
912507561 1:110166608-110166630 TATTTGAAAAGTAAACCTAAAGG - Intronic
913150709 1:116040004-116040026 TGTTTGGTAAGGAAAAGTGAGGG - Intronic
913352524 1:117876798-117876820 TGTTTGATTAGGAAACCTAAAGG - Intronic
915927710 1:160036550-160036572 TGTTTGGTTAGAATACATTAAGG - Intergenic
916567994 1:165998508-165998530 TGTTTTGTAAGAAAACCTGATGG + Intergenic
916589204 1:166174148-166174170 TGTTTGGTAGGGAAACCTATGGG - Intergenic
917277289 1:173344450-173344472 TGGTTGGTAATAAAATGTAAAGG + Intergenic
917342807 1:173996922-173996944 TTTTGGGTAACAAAACTTAACGG + Intronic
918051392 1:180975938-180975960 TTTGTGGTAAGAATAACTAATGG - Exonic
918764124 1:188456576-188456598 AGTTTAGAGAGAAAACCTAAAGG - Intergenic
920743899 1:208607303-208607325 TGTTTGTTAAGAAAATAAAAAGG + Intergenic
920801053 1:209187861-209187883 CCTTTGGGAAGAAAGCCTAATGG + Intergenic
924705839 1:246501389-246501411 TTTTTGGTCAGGAAACCCAAAGG - Intronic
1062978663 10:1703716-1703738 TTTTAGGTAAGAGAACCCAATGG + Intronic
1063509383 10:6631722-6631744 TGTTTGGACAGAAAGCCTACAGG + Intergenic
1064512185 10:16107535-16107557 TGGTTTGAGAGAAAACCTAATGG - Intergenic
1065103373 10:22354235-22354257 TGTTTGATAAGAAATGTTAAAGG + Intronic
1065863306 10:29890520-29890542 TGTGTGATAACAAAACCCAAAGG - Intergenic
1066028661 10:31393850-31393872 TGTTTGATATGCAAACTTAAAGG - Intronic
1066034199 10:31464853-31464875 TGCTTCGTAAGAAAAACTGAAGG + Intronic
1066153771 10:32652960-32652982 TGTTTTATAAGAAATACTAAAGG - Intronic
1066526672 10:36287600-36287622 TGTTTTGTAAGAAATGCTAAAGG - Intergenic
1067992804 10:51234523-51234545 TGTTTGGTAAGAAAACCTAAAGG - Intronic
1068077101 10:52270017-52270039 TGTTTGAGAAGAAAAACAAACGG + Intronic
1068304169 10:55182216-55182238 TATTTGGAAACAAAACCAAAAGG + Intronic
1069883025 10:71605787-71605809 TGTTTAGTAAGAAAAACTGGAGG - Intronic
1070285388 10:75079690-75079712 TGTTTGGCGAGAAGGCCTAAGGG + Intergenic
1072058076 10:91780708-91780730 TGTTTATCAAGAAAACTTAAAGG + Intergenic
1073394951 10:103209851-103209873 TGTTTGGACAGAAAGGCTAACGG - Intergenic
1073692220 10:105821973-105821995 TGTATATTAAGAAATCCTAAAGG + Intergenic
1074426542 10:113356469-113356491 TTTTTGCTGAGAAAACCCAATGG - Intergenic
1080572913 11:33572465-33572487 TATATGTTAAGAAAACCTTATGG - Intronic
1080953872 11:37069401-37069423 TGTTCTGTAAGAAAGCCTAGAGG + Intergenic
1081001720 11:37681848-37681870 TGTTTTATAAGAAATGCTAAAGG - Intergenic
1081179020 11:39965150-39965172 TCTTAGGGAAGAAAGCCTAATGG - Intergenic
1081951852 11:47051365-47051387 TCTTTGGCAGGAAAACCCAAAGG + Intronic
1084599420 11:70136100-70136122 TGTTTGGGGAGAAACCCTCAAGG + Intronic
1087049878 11:93875468-93875490 TTTTTAGTAAGAAAGCTTAAAGG - Intergenic
1087807996 11:102577047-102577069 TATTAGGTAAGAAAAAATAATGG + Exonic
1088580316 11:111309327-111309349 TGTTAGATAAGAGAAACTAATGG - Intergenic
1089779965 11:120866788-120866810 TTATTGGCAAGAAAACCAAAGGG - Intronic
1090297586 11:125602759-125602781 GTTCTGGTAAGACAACCTAATGG + Intronic
1090305890 11:125690636-125690658 TGTTTAGAAGGAAAACCGAAAGG + Intergenic
1091461903 12:649891-649913 TGTTTTGGAAGAATACTTAAGGG - Intronic
1093585148 12:20826731-20826753 TTTTTGGTAAGAAAAGCTGAAGG - Intronic
1094165667 12:27440333-27440355 TGTTGTGCAAGAAAAGCTAACGG + Intergenic
1096418522 12:51435144-51435166 TATTTGGTAAGATTACCTCATGG + Intronic
1096907001 12:54945231-54945253 TGTTTGGACAGAAAGGCTAAAGG + Intergenic
1097952745 12:65450610-65450632 TGTTTTGTTAGAAGACCAAAAGG + Intronic
1098520186 12:71426579-71426601 AGCTTGGTAAGAAAACAAAAGGG + Intronic
1098666191 12:73166155-73166177 TTTTTTGTAAGAAAACTTAAAGG + Intergenic
1100650395 12:96581805-96581827 TGTTTTGGAAGAATACTTAATGG - Intronic
1100993332 12:100274536-100274558 AGTTTGATAAGAAATACTAAAGG - Intronic
1101078681 12:101158934-101158956 TTTTTGTAAAGAAAACCTTAGGG - Intronic
1101089132 12:101266728-101266750 TGTTTTGAAAGAGAACTTAAGGG - Intergenic
1105792212 13:23812629-23812651 TGGTAGGGAAGAAAGCCTAATGG - Intronic
1108812119 13:54240158-54240180 TGTTTGATGTGAAAACCCAAAGG - Intergenic
1109453753 13:62555076-62555098 TGTTAGATAAGAAAATCTATGGG + Intergenic
1109647468 13:65277030-65277052 TGTTTGTTAAGCAACCTTAATGG + Intergenic
1111317064 13:86577318-86577340 TGGTTGGTAACAAAGCCTGATGG - Intergenic
1111630650 13:90843021-90843043 TGTTTGGAAAGAAAGGCTACAGG - Intergenic
1112115638 13:96349794-96349816 TGTTTGGTAAGCAAAGATTAAGG + Intronic
1112912003 13:104497688-104497710 TGTTTCCTAAGAAAATCTCATGG + Intergenic
1113115935 13:106874986-106875008 TGTTTCATAAGAAAAGCTACTGG - Intergenic
1115057138 14:29142525-29142547 TTTTTGGAAAGGAAATCTAAGGG + Intergenic
1116075673 14:40107542-40107564 TGTTAGGAAAGAAATTCTAAGGG + Intergenic
1116640244 14:47452573-47452595 TGTTTTGGAAGAATTCCTAAAGG - Intronic
1117261896 14:54043791-54043813 TGGCTGGTATTAAAACCTAAGGG + Intergenic
1117564140 14:56976542-56976564 TATGTGGCAAGAAAACCCAAAGG - Intergenic
1118510641 14:66468820-66468842 TTTTTTGTAAGAAAGCTTAAAGG + Intergenic
1119969650 14:78955567-78955589 CATTTAGTAAGGAAACCTAAAGG - Intronic
1120428310 14:84379293-84379315 TGTTTTGCAAGAAATGCTAAAGG + Intergenic
1122596556 14:102897458-102897480 AGTTTGCTAAGAAACCCTTAAGG - Intronic
1123727544 15:23119365-23119387 TGTTTGGAGAGAAGACCAAATGG + Intergenic
1124392577 15:29273033-29273055 TCTTAGGGAAGAAAGCCTAATGG + Intronic
1124531479 15:30511787-30511809 TGTTTGGAGAGAAAACCGAATGG + Intergenic
1124767178 15:32495908-32495930 TGTTTGGAGAGAAAACCGAATGG - Intergenic
1124873855 15:33572331-33572353 TGTCTTGTAAGAAATACTAAGGG - Intronic
1125083067 15:35698137-35698159 TGTTGGGGAAGAAAAAATAAGGG - Intergenic
1125971074 15:43912285-43912307 TGTTTGCCAAGAAAAACGAAAGG + Intronic
1127197966 15:56610522-56610544 TGTTTTGTAAGAAAACTCATTGG - Intergenic
1128563042 15:68681231-68681253 TTTTTGGAAAGAAAAGCTGAGGG + Intronic
1129130407 15:73488330-73488352 TGTTTGGAAGAAAACCCTAAAGG - Intronic
1131734469 15:95317341-95317363 TGTCTGTAAAGAAAAGCTAAGGG + Intergenic
1131922114 15:97339625-97339647 GGTTTGGTAACAAAACCTATGGG - Intergenic
1132325124 15:100962609-100962631 TGTTTAGAAAGAAAATCTAAAGG - Intronic
1132423786 15:101696755-101696777 TCTTAGGAAAGAAAGCCTAATGG - Intronic
1135429086 16:22366918-22366940 TGTTTTGAAAGTAAAGCTAAAGG + Intronic
1135918592 16:26627590-26627612 TCTTAGGAAAGAAATCCTAATGG - Intergenic
1136772629 16:32855148-32855170 TTTCTGGAAAGAAAACCAAAGGG - Intergenic
1136897985 16:34006371-34006393 TTTCTGGAAAGAAAACCAAAGGG + Intergenic
1138009724 16:53366862-53366884 TGTTTGGAGAGAAAACCGAAAGG - Intergenic
1138889250 16:61122138-61122160 GGTTTGGAAAGAAAAGCTGATGG + Intergenic
1138931369 16:61660902-61660924 TGTTTACTAAGAAATACTAAAGG + Intronic
1139024406 16:62796772-62796794 TTTTTGGTAAGTGAACCAAAAGG - Intergenic
1141396255 16:83707813-83707835 TCTTTGGTGAGAGACCCTAAAGG + Intronic
1203075054 16_KI270728v1_random:1117258-1117280 TTTCTGGAAAGAAAACCAAAGGG - Intergenic
1143931522 17:10433392-10433414 TGCTTGATAAGAAATACTAAAGG - Intergenic
1144267328 17:13583598-13583620 AGTTTGATAAAAAAATCTAAGGG - Intronic
1146204795 17:30894178-30894200 TTTTTGGTAATAAATCGTAAAGG + Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1147616695 17:41833243-41833265 TGATAGGTAAGAAAACTTTAGGG + Intronic
1148176792 17:45573017-45573039 TGTTTGGGAGGTAAACCTCAGGG + Intergenic
1148294585 17:46489930-46489952 TGTTTGGGAGGTAAACCTCAGGG - Intergenic
1150039786 17:61847748-61847770 AGTTTGGAAAGAAAACTTAGTGG - Intronic
1151059582 17:71076475-71076497 TGTTTTGAAAAAAATCCTAAAGG - Intergenic
1151252887 17:72851167-72851189 GGTTTGCTCAGAAAACCCAAGGG - Intronic
1152824713 17:82457611-82457633 TCTTAGCCAAGAAAACCTAATGG + Intergenic
1153444287 18:5154694-5154716 CGTTAGGGAAGAAAGCCTAAAGG - Intronic
1154407183 18:14103600-14103622 TGTTTGGTAAAAATAGCTAAGGG + Intronic
1154451812 18:14484142-14484164 TGTTTGGAAATAAAAACTCATGG + Intergenic
1155884458 18:31190330-31190352 TGTTTGGGTAGAAAAGCCAATGG + Intergenic
1156009974 18:32485922-32485944 TGCTTTCTATGAAAACCTAAGGG - Intergenic
1156426903 18:37023654-37023676 TGTATGGAAAGTAAACCCAATGG - Intronic
1156763629 18:40624783-40624805 TGTTTGGTCAGAAATCATAAGGG + Intergenic
1157842275 18:50969392-50969414 TTTTTGGCAAGAGAACTTAATGG + Intronic
926890465 2:17635032-17635054 TGTGTGGAAGGAAAACCTCATGG - Intronic
928060134 2:28103859-28103881 TGTTGGATAAGAAAAGCCAAAGG - Intronic
928779498 2:34803094-34803116 TGTTTGGGCAGAAAGCCTACAGG + Intergenic
930958606 2:57232473-57232495 TGTTTGGACAGAAAGCCTACAGG - Intergenic
931054826 2:58457675-58457697 TGATAGCTCAGAAAACCTAATGG + Intergenic
931841517 2:66155050-66155072 TGTCTGGTAATAGAACCCAAAGG - Intergenic
933151441 2:78919781-78919803 TGTATGGAAAGAAAACATCAGGG - Intergenic
935318270 2:101859514-101859536 TGTTTTGTAAGAAAGCAAAATGG - Intronic
936586358 2:113761842-113761864 TGTATGTGATGAAAACCTAAGGG + Intergenic
937491587 2:122374074-122374096 TATTCTGTAAGAAAAGCTAAAGG + Intergenic
937727765 2:125187287-125187309 TGTTGGGAAAGTAAAACTAAGGG - Intergenic
938254968 2:129850521-129850543 GCTTTGGTAAGAAAGCCTAGTGG + Intergenic
939204537 2:139083466-139083488 TGTTTTGTAGAGAAACCTAAAGG + Intergenic
939460527 2:142491968-142491990 TGTTTGGACAGAAAAGCTACAGG + Intergenic
940217080 2:151312632-151312654 TGTTTGGACAGAAAGCCTACAGG - Intergenic
940448088 2:153802148-153802170 TGATTTCTAAGAAAACTTAAGGG - Intergenic
941098894 2:161275436-161275458 TATCTGGTCAGAAACCCTAAAGG + Intergenic
941563053 2:167073425-167073447 TGTTTTGTAAGAAAATCCTATGG + Intronic
942029442 2:171944433-171944455 TTTTTGGTGAGAAAACTTCATGG + Intronic
943050835 2:182911083-182911105 TCTTAGGAAAGAACACCTAATGG - Intronic
943518735 2:188920350-188920372 TTTATGGTATGAAAACCCAAAGG + Intergenic
947469151 2:230384579-230384601 TGTTTGGAAAGAAAAACAAGTGG + Intronic
949029312 2:241783410-241783432 TTTTTGGTAAGAAAGCTTAAAGG - Intronic
1168910250 20:1441502-1441524 TGGTTGGTAAGAGAACCTCCTGG - Intergenic
1171398375 20:24855403-24855425 TCTTAGGGAAGAAAACCTAATGG + Intergenic
1171576267 20:26323836-26323858 TGTTTCCAAAGAAAACCTCAAGG - Intergenic
1174330746 20:49815292-49815314 TGTTTGATATGAAAACCAAATGG - Intronic
1176990737 21:15493091-15493113 TCTTTGCTAATAAAAGCTAATGG - Intergenic
1177174818 21:17691902-17691924 TCTTTGCAAAGAAAACCTGAGGG + Intergenic
1177231681 21:18329458-18329480 TTTTTGGTAAGAAAATATATTGG + Intronic
1177633345 21:23754743-23754765 TGAGTGATAAGAAAACATAATGG - Intergenic
1178859863 21:36279604-36279626 CATTTGGAAAGAAAAGCTAAGGG + Intronic
1178956484 21:37027110-37027132 TCTTTTGTAAGAAAATCTATTGG - Intergenic
1182989430 22:34752842-34752864 AGTTTGGGAAGAAAACATGACGG - Intergenic
949334045 3:2953992-2954014 TGTTTAGTATGAAAACCAAAAGG - Intronic
949685828 3:6568937-6568959 TGTTAGGTAAGAAGAAATAAAGG + Intergenic
951772824 3:26277939-26277961 TTCCTGGTATGAAAACCTAATGG - Intergenic
951826177 3:26871574-26871596 TGTTCTGTAAGAGAACCTAGAGG - Intergenic
952663250 3:35876453-35876475 TGTTTGGACAGAAAGCCTACAGG + Intergenic
955630755 3:60971706-60971728 TTTTTGGTAAGATTACCTCATGG + Intronic
955740481 3:62085718-62085740 TGTTTGCTTAGAAAATCTGAAGG - Intronic
956962739 3:74421713-74421735 TCTGTGGGAAGAAAACCAAATGG + Intronic
957365278 3:79214364-79214386 TGTTGGGTCACATAACCTAAGGG + Intronic
959116917 3:102189488-102189510 TTTCTGGTAATAAAAGCTAAGGG - Intronic
962892931 3:139688628-139688650 TGTTTGGGAAGACACCTTAATGG + Intergenic
963196258 3:142533658-142533680 AGGCTGGTAAGAAAAACTAAAGG - Intronic
963443129 3:145366890-145366912 TCTTGGGGAAGAAAACCTAACGG - Intergenic
963745433 3:149119993-149120015 TGTTGGGTAGGAAAATCTGATGG - Intergenic
965783187 3:172309700-172309722 TGGTTAGTAATAAAACCTCAGGG - Intronic
966282753 3:178252932-178252954 TGTTTAGTTAGAAAAGCTGATGG - Intergenic
967211950 3:187177655-187177677 TGTTTGGACAGAAAGCCTACAGG + Intronic
967356322 3:188575971-188575993 TGTTTGGAAAGAAGCCCTATTGG + Intronic
971202704 4:24526253-24526275 TTCTCTGTAAGAAAACCTAATGG + Intronic
971913416 4:32826495-32826517 TTTTTGGTAAAAAAGCTTAAAGG - Intergenic
972025446 4:34370858-34370880 TGATTGGTAAGAAAACTTTAAGG + Intergenic
972468466 4:39381623-39381645 TGTTCTGTAAGAAATGCTAAAGG - Intergenic
972937356 4:44154208-44154230 CATTTGGAAAAAAAACCTAAGGG - Intergenic
975148176 4:70993236-70993258 TGTGTGGTAGGAAAATCAAATGG - Intronic
975747989 4:77493394-77493416 TTTCTGGTAAGAAAAACAAAGGG - Intergenic
976130080 4:81874641-81874663 TCTTTGGTTAGAAATCCTGAGGG - Intronic
977029846 4:91868320-91868342 TTTTTGGTAAGAAAATATAATGG + Intergenic
978054098 4:104241419-104241441 TGGTTGGTAAGCAACACTAAAGG - Intergenic
979502867 4:121460249-121460271 TTTTAGGTAAGAAAATCGAAAGG + Intergenic
980606789 4:135102425-135102447 TGTGTGGTAAGAAAACAAATAGG - Intergenic
981530198 4:145744992-145745014 TGTATGAAAAGAAAAACTAAGGG - Intronic
981884216 4:149653291-149653313 TGTTTGGTAAGAGAGTCTGATGG - Intergenic
982168750 4:152640569-152640591 TGTTTGGTAAGGAAAACAGATGG - Intronic
982568639 4:157020504-157020526 TGTGTGGTAAGGAAACTTACAGG + Intergenic
982898672 4:160969048-160969070 TATTTGGGAAAAAAACCTCAGGG + Intergenic
983367402 4:166810765-166810787 TATTTGGTAACAAAATATAAAGG - Intronic
983472368 4:168173227-168173249 TGTAAGGTAAGAAAAGCTAATGG + Intronic
984570190 4:181382789-181382811 TCTTTGGTATGAAAATCTAATGG - Intergenic
984733757 4:183091699-183091721 TTTTTGTTAAGAAAACTTTATGG - Intergenic
985108501 4:186522589-186522611 TATTAAGTAAGAAATCCTAATGG - Intronic
985891321 5:2717339-2717361 TGTTTGGTAAGTAAACACAATGG - Intergenic
986777413 5:11029919-11029941 TGCTCTGTAAGAAATCCTAAAGG - Intronic
987088852 5:14493116-14493138 TGTTTGTTTAAGAAACCTAAGGG + Intronic
987746682 5:21982802-21982824 TATTTGGTAATAAAACAAAAAGG - Intronic
987756036 5:22098422-22098444 TGTTTGGACAGAAAGGCTAAAGG - Intronic
987826830 5:23041711-23041733 TGTTTGTTAGGAAAACCTGATGG + Intergenic
987877812 5:23702151-23702173 TGTATTTTAACAAAACCTAATGG - Intergenic
990452673 5:55950630-55950652 AGTATGGTTAGAAAACCCAAGGG + Intronic
990854891 5:60253595-60253617 TTTTTGGTAAAAACACCTCATGG - Intronic
991393601 5:66178019-66178041 TGTTGGGTTAGAATACCTAATGG + Intronic
991766855 5:69992565-69992587 TATTTGGTAATAAAACAAAAAGG - Intergenic
991846087 5:70867639-70867661 TATTTGGTAATAAAACAAAAAGG - Intergenic
992048008 5:72916355-72916377 TGACTGGTACAAAAACCTAAAGG - Exonic
993192922 5:84702061-84702083 TGTTTGGACAGAAAAGCTACAGG - Intergenic
994130456 5:96221344-96221366 CTTATGTTAAGAAAACCTAAAGG + Intergenic
994729110 5:103471077-103471099 TGTTTGGTGAAAAACCGTAAAGG + Intergenic
994794930 5:104285227-104285249 TTTTTAGTAAGAAAATCTATTGG - Intergenic
994844041 5:104962639-104962661 TGTTTGTAAGGAAAACCTTATGG - Intergenic
995883917 5:116871566-116871588 TCTTTGGAAAGAAAAGTTAAGGG + Intergenic
1001016895 5:168149952-168149974 TGTTTGAGCAAAAAACCTAAAGG - Intronic
1001818051 5:174687948-174687970 TGTTTTTTAAGAAAAGCTTATGG + Intergenic
1003381494 6:5628579-5628601 TGTTTGGACAGAAAACCAAAGGG + Intronic
1003963454 6:11230841-11230863 TTTATGGAAAGAAAATCTAAAGG - Intronic
1006799182 6:36748712-36748734 TTTTTGGTAAGACAACTTCATGG - Intronic
1006825634 6:36933326-36933348 GATTTAGTAAGAAAGCCTAAAGG - Intergenic
1008484147 6:52017037-52017059 TGTTTGGAAAGAAAAGAAAAAGG + Intronic
1009764459 6:68052576-68052598 TATTTGTTAAGAAAAAATAATGG + Intergenic
1010061951 6:71633776-71633798 TGTCTGATAAGAAATGCTAAAGG - Intergenic
1010717037 6:79241942-79241964 TATTTGGTAAGCAACACTAAAGG - Intergenic
1010841089 6:80649892-80649914 TGTTTGGACAGAAAAGCTACAGG + Intergenic
1010931277 6:81806698-81806720 TGATTGGTAAGAAAATCCAAAGG - Intergenic
1011809373 6:91112875-91112897 TGTTAGAGAAGAAAGCCTAATGG - Intergenic
1012086396 6:94831374-94831396 TCTGTGCTAAGAAAACCCAAGGG - Intergenic
1012093054 6:94923517-94923539 TTTTTGTCAAGAAAACCTATTGG - Intergenic
1012316025 6:97783163-97783185 TGTTTGGACAGAAAGCCTACAGG - Intergenic
1012359151 6:98355185-98355207 TTTTTGGTCAGAAGACCAAAAGG + Intergenic
1014454659 6:121622565-121622587 TGTTTGGACAGAAAGGCTAAAGG + Intergenic
1014564519 6:122931317-122931339 GACTTAGTAAGAAAACCTAAAGG + Intergenic
1015818434 6:137234351-137234373 TTTTTGTTAAGAATACCTATTGG + Intergenic
1020532502 7:9355550-9355572 TGTTTGGACAGAAAGCCTACAGG + Intergenic
1021657772 7:22889342-22889364 TGTTCGGTAAGCAAACTTAAAGG - Intergenic
1022076953 7:26981233-26981255 TGTTTAGTAAGATATCCCAAAGG - Intronic
1022120833 7:27306473-27306495 GTTTTGGTCAGAAAACATAAGGG - Intergenic
1023744438 7:43309731-43309753 GATTTTGTAAGAAAACCTGAAGG + Intronic
1026350787 7:69513456-69513478 TCTTAGGAAAGAAAGCCTAATGG + Intergenic
1027920516 7:84387503-84387525 TGTTTTGGACAAAAACCTAACGG + Intronic
1031904200 7:127442821-127442843 TGTTTGAGTAGAAAAGCTAATGG - Intergenic
1032315293 7:130832458-130832480 TGTTTTGTAAGTACACTTAAAGG + Intergenic
1033088798 7:138366317-138366339 TGTTTGGACAGAAAGCCTACAGG - Intergenic
1036155718 8:6340191-6340213 TTTTTGGTAAGAAAATAGAAGGG - Intergenic
1036925546 8:12901701-12901723 TGTTTGGAAAGAAAGCTTATTGG + Intergenic
1038102794 8:24397787-24397809 TGCTTGATAAGTAAACTTAAAGG - Intronic
1038221920 8:25617122-25617144 TGCTTGGCAAGAAATGCTAATGG + Intergenic
1038388292 8:27170543-27170565 TGCATGGAAAGAAAAACTAAAGG - Intergenic
1041040860 8:53844435-53844457 TGTTTTGAAAGCAAATCTAAGGG + Intergenic
1041893433 8:62897328-62897350 TGTATTGTAAGAAAAGCTTATGG + Intronic
1041917868 8:63154098-63154120 TCTTAGGAAAGAAAGCCTAACGG + Intergenic
1042205819 8:66328770-66328792 TTTTAGGGAAGAAAGCCTAAGGG - Intergenic
1042761999 8:72281254-72281276 TCTTTGGCAAGAAAGCCTAAGGG + Intergenic
1042809550 8:72809123-72809145 TGATTGCTAAGATAACTTAATGG - Intronic
1042820653 8:72926566-72926588 TTTATGTTAAGAAAAGCTAATGG - Intronic
1042840299 8:73116825-73116847 TGGTGGGTCAGAAAACCTGAGGG + Intronic
1044417302 8:91951544-91951566 TGTTTGGACAGAAAAGCTACAGG - Intergenic
1044492944 8:92842290-92842312 TGTGTGGTAAAAAAACAGAAAGG - Intergenic
1044786859 8:95803456-95803478 TGTTTTGTAAGAAAGTCTAATGG + Intergenic
1047836384 8:128698012-128698034 TGCTTGGTATGAAAACCAAATGG + Intergenic
1048607915 8:135989181-135989203 TGATGAGTGAGAAAACCTAAGGG - Intergenic
1048884432 8:138898331-138898353 TGTTTGCTAAGATAACCAAAGGG - Intronic
1049114087 8:140670994-140671016 TGTTTGGAAAGACATCCTAATGG + Intronic
1053620799 9:39813571-39813593 TGCTTTATAAGAAACCCTAAAGG - Intergenic
1053625914 9:39870367-39870389 TGCTTTATAAGAAACCCTAAAGG + Intergenic
1053878958 9:42572853-42572875 TGCTTTATAAGAAACCCTAAAGG - Intergenic
1053893707 9:42721496-42721518 TGCTTTATAAGAAACCCTAAAGG + Intergenic
1054217974 9:62380334-62380356 TGCTTTATAAGAAACCCTAAAGG - Intergenic
1054232734 9:62528842-62528864 TGCTTTATAAGAAACCCTAAAGG + Intergenic
1054263364 9:62893871-62893893 TGCTTTATAAGAAACCCTAAAGG + Intergenic
1055181431 9:73391927-73391949 TTTTTGGTAAGAAAACATTGTGG - Intergenic
1055857194 9:80703513-80703535 TGATTGGTTAGAAAACATTATGG - Intergenic
1056257408 9:84814118-84814140 TTTCTGGAAAGAAAACCTAGTGG - Intronic
1056648918 9:88440912-88440934 TTTTTTGTAAGAAAACACAAAGG - Intronic
1058384060 9:104412296-104412318 TTTTTGGTAAGCAAGCTTAAAGG + Intergenic
1058398655 9:104587600-104587622 TGTTAGGAAATTAAACCTAAGGG + Intergenic
1060068939 9:120529666-120529688 TGTATCCTAAGAAAACCCAAAGG + Intronic
1061068517 9:128294315-128294337 TGTAAGGTGAGAAAACCTCAAGG - Intergenic
1186480011 X:9889564-9889586 TGTCTGGTTAGAAATCCCAATGG - Intronic
1187321880 X:18246513-18246535 TGTTAGGTATGAAAATCTCAAGG + Intronic
1187816455 X:23237772-23237794 TTTTTGGTAAGAAAGCTTAAAGG + Intergenic
1188126150 X:26372151-26372173 TGTTTTGTAAGAACAATTAAAGG + Intergenic
1188269859 X:28125694-28125716 TGTTTGGAAAGAAATCCCAAAGG - Intergenic
1188400570 X:29738970-29738992 TTTTTGGTCAGACAATCTAATGG + Intronic
1189635195 X:43000227-43000249 TCTTTTGTAAGAAAACCATATGG - Intergenic
1190383154 X:49859062-49859084 TGATTGATTAGAAAACCAAATGG - Intergenic
1193899450 X:87159535-87159557 TGTTTTATAAGAAATGCTAAAGG - Intergenic
1194041394 X:88945834-88945856 TCTTAGGGAAGAAAGCCTAATGG - Intergenic
1194416952 X:93625905-93625927 TCTTTAATAAGAAAACGTAAAGG - Intergenic
1196832635 X:119788190-119788212 GGTTTGCTAAGAAGACTTAAAGG - Intronic
1197542812 X:127787437-127787459 TGTTTTCTAAGAAATACTAAAGG - Intergenic
1197930696 X:131691868-131691890 TTTCTGGTAAGAAAACCTCCTGG - Intergenic
1198966168 X:142230350-142230372 TGTTTGGACAGAAAGCCTACAGG - Intergenic
1199273557 X:145914694-145914716 TCTTTGGCAATAAAACATAATGG + Intergenic
1201061484 Y:10050603-10050625 TGTTTGGACAGAAAAGCTACAGG + Intergenic